معلومة

بعد تكرار الحمض النووي خلال المرحلة S من دورة الخلية ، هل تخضع جميع المناطق الجينومية لنفس المستوى الصارم لإصلاح الحمض النووي؟

بعد تكرار الحمض النووي خلال المرحلة S من دورة الخلية ، هل تخضع جميع المناطق الجينومية لنفس المستوى الصارم لإصلاح الحمض النووي؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

حسب فهمي (المحدود) ، هناك طريقتان رئيسيتان يمكن أن تحدث بها الطفرات في الحمض النووي: البيئة (الأشعة فوق البنفسجية ، إلخ) والأخطاء أثناء انقسام الخلية.

كنت أتساءل عما إذا كانت هناك آلية يمكنها إعطاء الأولوية لجينات معينة ليتم تكرارها بدقة. نوع من الزناد يقول "تحقق مرة أخرى من هذا الجين المحدد قبل الاستمرار في النسخ ".

وإذا كان هناك يكون مثل هذه الآلية ، فأنا أتساءل إذا كان هناك نوع من نظام الاعتماد على الجينات التي تتحكم في مجموعات من الجينات الأخرى. لذلك ، إذا قام جين معين "بتنشيط" مشغل الفحص المزدوج ، فإنه سيضيف تلقائيًا هذا المحفز إلى مجموعة الجينات التي تتأثر به.

شكرا.


حتى الآن ، تتمثل الآلية المعروفة لإصلاح الحمض النووي في التعرف على عدم التطابق أو النيوكليوتيدات التالفة بواسطة الإنزيمات المحيطة بالحمض النووي بدلاً من المسح الضوئي على طول الحمض النووي. لذلك لا يمكن إجراء فحص مزدوج في ظل هذه الظروف.


تنشأ طفرات الحمض النووي إما من أخطاء النسخ المتماثل أو من تأثير المطفرات. يمكن أن ينتقل الانقسام الخلوي إلى ما يعرف بـ G0 المرحلة حيث يتم وضع الانقسام في الانتظار. يشار إلى هذه الحالة أيضًا على أنها حالة هادئة (انظر الجينات ذات الصلة هنا) ، والتي تختلف عن الحالات الشائخة حيث يتم منع الخلايا التالفة من التكاثر ، على سبيل المثال ، من خلال عائلة الجينات p53. يتم تنظيم بروتينات هذه الجينات المذكورة مؤخرًا لقمع الانقسام غير المنضبط في الخلايا السرطانية ، في حين أن الجينات التي تتحكم في G0 تعمل المرحلة في ظل الظروف الفسيولوجية العادية ، ما لم تكن هذه الجينات ذات الصلة ناقصة بحد ذاتها. المواد المسرطنة هي مجموعة فرعية من المطفرات التي تؤثر عادة على الجينات المشاركة في دورة الخلية.


كنت أتساءل عما إذا كانت هناك آلية يمكنها إعطاء الأولوية لجينات معينة ليتم تكرارها بدقة. نوع من الزناد الذي يقول "تحقق مرة أخرى من هذا الجين المحدد قبل الاستمرار في التكرار".

الآلية التي تقول: "تحقق مرة أخرى من هذا الجزء ، إنه مهم" ليست معروفة لي أيضًا ، ولكن إذا فهمت سؤالك بشكل صحيح ، أعتقد أن الإجابة على سؤالك تكمن في مكان آخر.

لنبدأ بمعدل الطفرة الذي ذكرته ، فبعض التسلسلات يصعب تكرارها بواسطة بوليميراز الحمض النووي (يرتكب المزيد من الأخطاء هناك ، كما هو الحال في التسلسلات شديدة التكرار ، والسيتوزينات الميثيلية ، وما إلى ذلك) ، وبالتالي يكون معدل الطفرات أعلى في هذه الأجزاء (هم كذلك) تسمى النقاط الساخنة للطفرات) ، ولكن بخلاف ذلك ، فإن بوليميراز الحمض النووي يخطئ بشكل عشوائي ، في جميع أنحاء الجينوم بأكمله. هذه في حالة أفضل إصلاحها. بدون عناية خاصة ، يحاول إصلاح البوليميراز إصلاح كل شيء.

الآن ، من وجهة نظري. ماذا لو فشل الإصلاح؟ في الجينات ، يعد ذلك أمرًا بالغ الأهمية لبقاء الخلية وتطور الكائنات الحية وما إلى ذلك (لأنها الحياة) ترى حقًا عددًا أقل من الطفرات (إن وجدت). (وأعتقد أن هذا كان سبب السؤال ، صححني إذا كنت مخطئًا).

علاوة على ذلك ، يمكن الحفاظ على هذه الأماكن في الجينوم بشكل كبير بين الكائنات الحية المختلفة. المزيد هنا. ما يقوله هذا هو أن الطبيعة لا تسمح للخلايا / التطور / من يفعل ذلك تجربة (أو يرتكب أخطاء) في هذه المواقف. إذا حدثت طفرة هنا ولم يتم إصلاحها ، فإن الخلية تموت ببساطة وبالتالي لا يمكنك رؤية الطفرة. قد يكون سبب الوفاة تراكم البروتين السام ، الذي لا تستطيع الخلية التخلص منه بفعل الإنزيم المعطل ، أو نقص الطاقة ، لأنه لا يمكن أن يؤكسد الوقود ... هناك الكثير من النتائج المميتة المحتملة. بالنسبة لبعض الجينات ، يمكن للخلية أن تحل محل منتجها ببروتين آخر ، لكن بعضها ضروري.

(في الكائن متعدد الخلايا يمكن أن يحل محلها ، وحيدة الخلية لن تهتم لأنها ميتة بالفعل)

أعتقد أن هذه هي الآلية التي يمكن من خلالها للخلية أن تميز بين الجينات المهمة والجينات "الأقل أهمية" التي كنت تطلبها.


يعد B-Myb أمرًا بالغ الأهمية لتكرار الحمض النووي بشكل صحيح أثناء مرحلة S غير المضطربة في الخلايا الجذعية الجنينية للفأر

السمة المشتركة للخلايا الجنينية المبكرة من كتلة الخلية الداخلية (ICM) والخلايا الجذعية السرطانية هي الاعتماد المطلق على دورة خلية غير نمطية يتم فيها تقصير مرحلة G1 للحفاظ على طبيعتها الذاتية التجديد والمتعددة القدرات. يُعزى عامل النسخ B-Myb دورًا في الانتشار ، لا سيما خلال مراحل G2 / M من دورة الخلية. من المثير للاهتمام أن مستويات B-Myb في ICM / ESCs أكبر من 100 مرة مقارنة مع تلك الموجودة في الخلايا الطبيعية المتكاثرة ، مما يشير إلى وظيفة مهمة بشكل خاص لعامل النسخ هذا في الخلايا الجذعية متعددة القدرات. يعتبر B-Myb ضروريًا لتطور الجنين بعد مرحلة ما قبل الانغراس ، لكن دوره في ICM / ESCs لا يزال غير واضح. باستخدام مزيج من علم الوراثة للفأر ، وتحليل ألياف الحمض النووي الفردي والتصوير ثلاثي الأبعاد عالي الدقة ، نوضح أن B-Myb ليس له أي تأثير على التعبير عن عوامل تعدد القدرات ، ولكن بدلاً من ذلك ، يؤدي استئصال B-Myb إلى توقف النسخ المتماثل الشوكات والتنشيط الفائق لمصانع النسخ المتماثل التي تؤدي إلى عدم تنظيم برنامج النسخ المتماثل وزيادة فواصل الشرائط المزدوجة. ترجع هذه التأثيرات جزئيًا إلى التنظيم النسخي الشاذ لعوامل انتشار دورة الخلية ، أي c-Myc و FoxM1 ، والتي تملي تقدمًا طبيعيًا في المرحلة S. نستنتج أن B-Myb يعمل بشكل حاسم خلال المرحلة S في ESCs من خلال تسهيل التقدم المناسب للنسخ المتماثل ، وبالتالي حماية الخلايا من التلف الجيني. النتائج التي توصلنا إليها لها أهمية خاصة في ضوء التطبيق العلاجي المحتمل لـ ESCs والحاجة إلى الحفاظ على سلامتها الجينية.


ملخص المؤلف

تسبب الطفرات في SAMHD1 متلازمة إيكاردي جوتيير (AGS) ، وهو مرض مناعي ذاتي أحادي المنشأ يشبه الذئبة. من بين الجينات المرتبطة بـ AGS ، يكون SAMHD1 في أغلب الأحيان تحورًا في أنواع مختلفة من الأورام والأورام الخبيثة ، مما يشير إلى أنه مرتبط بيولوجيًا بتطور السرطان. هنا ، نظهر أن SAMHD1 يحل حلقات R الناتجة عن تعارضات النسخ المتماثل ، مما يساهم في الحفاظ على استقرار الجينوم. توفر النتائج التي توصلنا إليها نظرة ثاقبة على الفهم الجزيئي والميكانيكي للمناعة الذاتية والأمراض المصاحبة للسرطان ، وتشير إلى أن حلقات SAMHD1 و R هي مؤشرات حيوية محتملة وموثوقة في العلاجات المضادة للسرطان.

الاقتباس: Park K و Ryoo J و Jeong H و Kim M و Lee S و Hwang S-Y وآخرون. (2021) يحافظ الجين المرتبط بمتلازمة إيكاردي جوتيير SAMHD1 على سلامة الجينوم عن طريق منع تكوين حلقة R في مناطق صراع النسخ والنسخ المتماثل. بلوس جينيه 17 (4): e1009523. https://doi.org/10.1371/journal.pgen.1009523

محرر: ناتاليا جروماك ، جامعة أكسفورد ، المملكة المتحدة

تم الاستلام: 6 أكتوبر 2020 وافقت: 29 مارس 2021 نشرت: 15 أبريل 2021

حقوق النشر: © 2021 بارك وآخرون. هذا مقال مفتوح الوصول يتم توزيعه بموجب شروط ترخيص Creative Commons Attribution License ، والذي يسمح بالاستخدام غير المقيد والتوزيع والاستنساخ في أي وسيط ، بشرط ذكر المؤلف والمصدر الأصليين.

توافر البيانات: تتوفر بيانات وأرقام المعلوماتية الحيوية الواردة في هذه الدراسة تحت GitHub (https://github.com/spiritmage72/samhd1_rloop). تم توفير نصوص python المخصصة المعدلة المستخدمة لتحديد إشارة DRIP-seq عبر مناطق HO و CD ضمن GitHub (https://github.com/spiritmage72/samhd1_rloop). جميع البيانات الرقمية الأساسية ذات الصلة لجميع الرسوم البيانية والإحصاءات الموجزة إما في جداول بيانات المعلومات الداعمة أو مضمنة في البيانات ذات الصلة.

التمويل: تم دعم هذا العمل من قبل معهد العلوم الأساسية التابع لوزارة العلوم (IBS-R008-D1) ومنحة المؤسسة الوطنية للبحوث الكورية الممولة من الحكومة الكورية (NRF-2020R1A5A1018081) (إلى KA) ، (NRF-2020R1A2C3011298) ) (إلى KA و KP) ، والزمالة BK21 plus (A0423-20200100) (إلى KP). لم يكن للممولين دور في تصميم الدراسة أو جمع البيانات وتحليلها أو اتخاذ قرار النشر أو إعداد المخطوطة.

تضارب المصالح: وقد أعلن الباحثون إلى أن لا المصالح المتنافسة موجودة.


مناقشة

إن فهمنا لوظائف منظمات النسخ الخاصة بالتسلسل محدود جزئيًا بمعرفتنا بالجينات المستهدفة. لقد طورنا بروتوكولًا قويًا لتحديد مواقع الارتباط الجينومي لعوامل ربط الحمض النووي في خلايا الثدييات التي تجمع بين الترسيب المناعي لمجمعات البروتين والحمض النووي المتشابكة مع تحليل المصفوفة الدقيقة للحمض النووي للمحفزات للجينات التي تنظم دورة الخلية. تم استخدام هذه الطريقة لتحديد المروجين المستهدفين الجدد لـ E2F ، والتي تحققنا منها باستخدام فحصين مستقلين. تشير نتائجنا إلى أن E2Fs متورطة في تنظيم الجينات التي تشفر مكونات نقطة تفتيش تلف الحمض النووي ومسارات الإصلاح ، بالإضافة إلى العوامل المشاركة في تجميع / تكثيف الكروماتين ، وفصل الكروموسوم ، ونقطة تفتيش المغزل الانقسامي.

حددت التجارب السابقة أهداف E2F عن طريق تحديد خصائص الجينات التي تم تنشيطها وقمعها استجابةً للتعبير خارج الرحم عن E2F1 و E2F2 و E2F3 (Ishida et al. 2001 Kalma et al. 2001 Muller et al. 2001). ومع ذلك ، يتم تقديم اثنين من القيود المحتملة لمثل هذه التجارب من خلال هذا النهج. أولاً ، هناك احتمال لفقدان خصوصية الهدف الناتج عن الإفراط في التعبير. ثانيًا ، لا يسمح هذا النوع من التجارب بتحديد مباشر أو لا لبس فيه للأهداف المباشرة ، حيث إن التغييرات الثانوية في التعبير الجيني الناتجة عن التقدم خلال دورة الخلية ممكنة (Ishida et al. 2001). على النقيض من ذلك ، فإن تجارب الربط المباشر الموصوفة هنا تتغلب على كل من المضاعفات وتسمح بتحديد المروجين المرتبطين مباشرة بـ E2F في الخلايا الأولية في ظل الظروف الفسيولوجية.

يشير ارتباط المنشط النسخي إلى منطقة المحفز للجين إلى أن المنشط له تأثير تنظيمي على الجين ، ولكن من الممكن أيضًا ألا يتحكم المنشط بالكامل أو حتى جزئيًا في الجين. لهذا السبب ، حددنا مجموعة الجينات حيث يرتبط ارتباط العامل بالتعبير الجيني ، وهو نهج أنتج معلومات دقيقة للغاية عن وظيفة عامل النسخ في دراسات سابقة مع عوامل أخرى (رين وآخرون ، 2000). لقد أكدنا أيضًا على أهمية ارتباط E2F بالعديد من الأهداف الجديدة المحددة هنا من خلال فحص التعبير الجيني في الخلايا التي تفتقر إلى مثبطات p107 و p130 المعينة بواسطة E2F4. وجدنا أن التعبير عن كل من هذه الأهداف قد تم تحريره بشكل كبير في الخلايا التي تفتقر إلى p107 و p130. تؤكد هذه النتائج الأهمية الوظيفية لربط E2F في الجسم الحي بالأهداف المحددة في تحليل الموقع لدينا.

تصنيف أهداف E2F

باستخدام مصفوفة ميكروأري جديدة للحمض النووي تسمح لنا بمراقبة ارتباط المحفز لمعظم الجينات البشرية التي من المعروف أن تعبيرها يتأرجح مع دورة الخلية ، حددنا عددًا كبيرًا من الجينات المفترضة المستجيبة لـ E2F. لم يتم ربط عدد كبير من جينات E2F المستهدفة سابقًا بوظيفة E2F. يمكن استخلاص العديد من الاستنتاجات المهمة من هذا العمل بناءً على التجميع الوظيفي لأهداف E2F التي حددناها.

تنظيم دورة الخلية

حددنا ثمانية جينات لها دور راسخ في التحكم في دورة الخلية. تتضمن هذه المجموعةسيكلين A ، Cdc2 ، Cdc25A ، CDK2، اثنان من أفراد عائلة E2F (E2F2 و E2F3) ، واثنين من أفراد عائلة RB (RB و ص 107). تم اعتبار كل من هذه الجينات على أنها مستجيبة لـ E2F ، ويؤكد عملنا أنها ، في الواقع ، أهداف فسيولوجية مباشرة لـ E2F.

تكرار الحمض النووي

تم إثبات دور E2F في تنشيط العديد من جينات تكرار الحمض النووي. تشمل أهداف E2F المعروفة جينات ترميز البروتينات المشاركة في بدء النسخ المتماثل (Orc1 ، Mcm البروتينات ، Cdc6) ، أيض النوكليوتيدات (thymidine kinase) ، والتوليف الأنزيمي للحمض النووي (DNA polymerase α). وسعت دراساتنا هذه القائمة لتشمل توليف النوكليوتيدات الإضافية وجينات عامل النسخ. تتوافق هذه النتائج مع عمل نيفينز وزملائه وآخرين (Ishida et al. 2001 Kalma et al. 2001) ، الذين حددوا مؤخرًا من خلال التنميط التعبري العديد من الجينات التي عزلناها كأهداف مباشرة لـ E2F.

نقطة تفتيش الانقسام الفتيلي والمغزل الانقسامي

كان العمل السابق على مدى العقد الماضي قد أسس دورًا أساسيًا لـ E2F في تنظيم G1/ S مرحلة الانتقال ، ومن الواضح الآن أن الأعاصير المهمة لهذا الانتقال ومجموعة من عوامل التكرار والإنزيمات هي أهداف فسيولوجية لـ E2F. ومع ذلك ، فإن الفكرة الناشئة من الدراسات الحديثة تشير إلى أن E2F قد يكون مطلوبًا لتنظيم التعبير الجيني للسيكلين بعد المرحلة S (Lukas et al. 1999) ، وحدد التنميط التعبيري العديد من الأهداف النهائية المحتملة المتضمنة في الانقسام (Ishida et al. 2001). ومع ذلك ، نظرًا للتحذيرات المرتبطة بهذا النوع من التجارب الموصوفة أعلاه ، لم يكن من الممكن التمييز بين الأهداف المباشرة وغير المباشرة. حددنا عددًا كبيرًا من الجينات التي تعمل في الانقسام الفتيلي. من بين هذه القائمة الجينات المعروفة بأنها تلعب دورًا في الحركية الخلوية (Plk,PRC1) ، تكاثف الكروموسوم (SMC4 ، SMC2) ، والفصل الكروموسوم (سيكورين أو PTTG1,CENP-E ، HEC1). تشير تجاربنا بقوة إلى أن E2F يلعب دورًا مباشرًا في تنظيم العديد من الجينات المشاركة في الانقسام الفتيلي. من المثير للاهتمام أن نلاحظ أننا حددنا أيضًا العديد من مكونات نقطة تفتيش المغزل الانقسامي ، بما في ذلك بروتينات CENP-E و Bub3 و Mad2 التي تتفاعل مع Bub1 ، والتي تم تحديدها على أنها هدف E2F بواسطة نيفينز وزملائه (Ishida et al. 2001). وبالتالي ، فإن عملنا يثبت أن E2F يربط بشكل مباشر مروجي الجينات المرتبطة بأحداث ما بعد المرحلة S ويقترح أنه يلعب دورًا مهمًا في تعبيرهم.

إصلاح الحمض النووي

ومن المثير للاهتمام أننا حددنا مجموعة كبيرة من 12 جينًا مطلوبة لإصلاح الحمض النووي. تشارك هذه الجينات في مجموعة كاملة من عمليات الإصلاح ، بما في ذلك إصلاح عدم التطابق (MSH2,MLH1)، إصلاح الاستئصال القاعدي (UNG)، إصلاح الختان النوكليوتيدات (RPA3) ، إعادة التركيب المتماثل (RAD51 و RAD54) ، والربط النهائي غير المتماثل (بروتين كيناز المعتمد على الحمض النووي). قد تشير هذه التجارب إلى الحفاظ على ظاهرة لوحظت لأول مرة في خميرة الخميرة، أي أن الجينات المشاركة في إصلاح تلف الحمض النووي قد تكون مطلوبة أثناء النسخ المتماثل لضمان السلامة الجينية (ميونغ وآخرون 2001). العديد من الجينات المعزولة في هذه الشاشة هي أعضاء في مجمعات متعددة الأقطاب ، وتشير بياناتنا إلى أنه قد يتم تنظيمها بشكل منسق. على سبيل المثال ، تم الإبلاغ عن تفاعلات FEN1 – PCNA و Rad51 – Rad54 و Msh2 – Mlh1 و Bard1 – Cstf1 ، كما تم العثور على عدة أزواج من البروتينات المتفاعلة بين الفئات الوظيفية الأخرى أيضًا. يبدو أن العديد من هذه الجينات مرتبطة بـ E2F4 في الخلايا الهادئة عندما يكون كل منها غير نشط وبواسطة المنشط E2F1 في G1/ خلايا الطور S عندما يتم التعبير عن كل منها (الشكل 3). علاوة على ذلك ، فإن تحليلنا للنوع البري وص 107 −/− ص 130 - / - تشير MEFs إلى أن اثنين على الأقل من هذه الجينات (RAD54L وBARD1) في الجسم الحي بواسطة هذه البروتينات المرتبطة بـ pRB خلال G0 وأوائل G1 (الشكل 5). تمشيا مع النتائج التي توصلنا إليها ، تم تحريض الفئران Rad51 على عدة أضعاف في الخلايا التي تعبر عن E2F1 أو E2F2 (إيشيدا وآخرون ، 2001). لذلك ، تربط النتائج التي توصلنا إليها عمليات تكرار الحمض النووي وإصلاحه في خلايا الثدييات وتشير إلى أنه يمكن تنظيم تعبيرها من خلال عامل مشترك ، E2F.

ضوابط نقطة التفتيش

كان أحد أكثر النتائج إثارة للدهشة هو تحديد مجموعة من الجينات المشاركة في عدة نقاط تفتيش مختلفة. حددنا اثنين من الجينات المتورطة في نقطة تفتيش تلف الحمض النووي ، ص 53 و Chk1. ص 53 يتم إحداثه استجابةً لتلف الحمض النووي ويعمل على فرض كتلة دورة الخلية في G1 المرحلة (Zhou and Elledge 2000). كان تحديد p53 كهدف E2F غير متوقع ، لأن ص 53 المروج يفتقر إلى موقع إجماع E2F يمكن التعرف عليه (البيانات غير معروضة). يمكن تفسير هذه النتيجة من خلال التوظيف غير المباشر لـ E2F من خلال عوامل إضافية مرتبطة بالمروج. لقد تم إظهار E2F سابقًا لزيادة مستويات p53 بشكل غير مباشر من خلال تنشيطص 14 ARF الجين ، أحد مكونات مسار التثبيت p14 ARF -Mdm2 (DeGregori et al. 1997Bates et al. 1998 Robertson and Jones 1998). تشير نتائجنا إلى أن E2F قد يتحكم بشكل مباشر أيضًا ص 53 مستويات التعبير. هذه النتيجة مثيرة للاهتمام أيضًا في ضوء التقارير السابقة التي تشير إلى دور أساسي لكل من p53 وعائلة pRB في G1 نقطة تفتيش لمنع تلف الحمض النووي (Harrington et al. 1998 Dannenberg et al. 2000 Sage et al. 2000). الآليات الكامنة وراء متطلبات pRB لهذا G1 الكتلة غير معروفة ، على الرغم من افتراض دور الجينات المستجيبة لـ E2F (Harrington et al.1998). جين نقطة تفتيش ثانية ، Chk1، تم تحديده أيضًا في تحليل موقع E2F الخاص بنا. مطلوب CHK1 لـ G2 تلف الحمض النووي (وربما مرحلة S) نقطة تفتيش (Zhou and Elledge 2000). ومن المثير للاهتمام ، أن pRB كان مطلوبًا لـ Chk1 أسفل التنظيم واستئناف G2 بعد تلف الحمض النووي ، مما يشير إلى أن E2F يمكن أن يكون متورطًا في Chk1 التعبير الجيني (جوتيفريدي وآخرون 2001).

حددنا أيضًا العديد من مكونات نقطة تفتيش المغزل الانقسامي ، بما في ذلك CENP-E و Bub3 و Mad2 و TTK kinase (متماثل من الخميرة Mps1p). لقد ثبت أن هذه البروتينات تتفاعل ، مما يشير مرة أخرى إلى أن نقطة التفتيش هذه يمكن التحكم فيها بشكل منسق بواسطة E2F. ومن المثير للاهتمام أننا وجدنا أن اثنين من هذه الجينات ، MAD2L وTTK، وكذلك العديد من الجينات الانقسامية (اللجنة العليا للانتخابات,NEK2، و PTTG1) ، تم إلغاء ضغطها بشكل كبير في G الهادئة والمبكرة1 الخلايا التي تعاني من نقص في مثبط E2F4 – p107 / p130.

بالاقتران مع تجارب التنميط التعبير وتحليلنا للنوع البري والمتحور MEFs ، تشير المجموعات المذكورة أعلاه إلى أن استجابة تلف الحمض النووي وعناصر التحكم في نقاط التفتيش قد يتم إدخالها في دورة الخلية من خلال تنظيم E2F (الشكل 6). أي أن كل من جينات الإصلاح ونقاط التفتيش هذه غير نشطة في الخلايا التي خرجت من دورة الخلية وليس لديها حاجة فورية للإصلاح. ترتبط هذه الحالة غير النشطة بالربط بواسطة E2F4.يبدو أن هذه الفكرة متوافقة مع الدراسات الحديثة التي أجريت على خلايا الفئران والتي تبين أن التكاثر كان مطلوبًا لإصلاح الطفرات (Bielas and Heddle 2000). ومع ذلك ، مع إعادة دخول الخلايا إلى دورة الخلية وتقترب من المرحلة S ، من الضروري تنشيط الجينات اللازمة لإصلاح تلف الحمض النووي الذي يحدث أثناء التكاثر. تتزامن هذه الفترة مع الوقت الذي يتم فيه التعبير عن E2F وربطه في الجسم الحي بالجينات المشاركة في تكرار الحمض النووي ومسارات الإصلاح.

نموذج يوضح الدور المتفشي لـ E2F في عدة مراحل من دورة الخلية وفي نقاط تفتيش متعددة. يشير الخط الأفقي الغامق إلى دورة الخلية. بالإضافة إلى تنظيم العديد من الجينات التنظيمية لدورة الخلية ، بما في ذلك تلك التي تشفر الأعاصير ، و CDKs ، و E2Fs الأخرى ، وعائلة pRB ، فإن E2F4 مرتبط بالجينات المشاركة في G1 وج2 نقاط تفتيش تلف الحمض النووي ، وتكرار الحمض النووي ، وإصلاح الحمض النووي. يرتبط E2F4 أيضًا بالجينات التي تعمل على تعزيز تكثيف الكروموسوم والعزل وكذلك نقطة تفتيش المغزل. على الرغم من أن E2F1 ربط العديد من الجينات المشاركة في الانقسام الفتيلي ، إلا أن معظم الجينات المرتبطة بعامل النسخ هذا في تحليل الموقع لدينا تتجمع في مسارات تكرار وإصلاح الحمض النووي.

وقد حددت تجارب التنميط الجيني الحديثة أيضًا عددًا من الجينات المشاركة في موت الخلايا المبرمج ، والتأشير ، والتمايز (مولر وآخرون ، 2001). على الرغم من حقيقة أن شظايا المروج لمجموعة فرعية من هذه الجينات تم تمثيلها في المصفوفة الدقيقة لدورة الخلية ، تجدر الإشارة إلى أن هذه الجينات لم يتم تحديدها في شاشة المصفوفة الدقيقة الخاصة بنا. أساس هذا التناقض غير معروف في الوقت الحالي ، على الرغم من أن البروتوكولات التجريبية المتباينة ، بما في ذلك استخدام خطوط الخلايا المختلفة والتعبير خارج الرحم مقابل التعبير الداخلي المنشأ لـ E2Fs ، قد يفسر التباين.


النتائج

الخميرة الانشطارية sld3 + ضرورية لنمو الخلايا

حددنا بروتينًا افتراضيًا (GenBank CAA90850.2) في قاعدة بيانات جينوم الخميرة الانشطارية. يشترك هذا البروتين بنسبة 14 ٪ في الهوية و 24 ٪ من التشابه مع الخميرة الناشئة Sld3 (الشكل 1 ب). تم تسمية الجين المشفر للبروتين باسم sld3 + ، كنظير محتمل للخميرة في مهدها SLD3. الsld3 + يشفر بولي ببتيد حمض أميني 699 مع كتلة جزيئية محسوبة ∼79 كيلو دالتون. لا يحتوي هذا البروتين على أشكال بروتينية مميزة ، باستثناء الأشكال المفترضة ذات الملف الملفوف في المناطق 142-165 و 253–341 لمواضع الأحماض الأمينية (الشكل 1 أ).

الشكل 1. هيكل S. بومبي SpSld3. (أ) يظهر التمثيل التخطيطي لـ SpSld3. تشير المربعات المظللة إلى مناطق الملف الملفوف التي تنبأ بها برنامج COILS. تشير العلامات النجمية إلى مواضع الأحماض الأمينية التي تغيرت بواسطة sld3-10,-41، و -52 الطفرات. (ب) تتماشى تسلسل الأحماض الأمينية المتوقعة مع تلك الموجودة في S. cerevisiae Sld3 ، باستخدام طريقة ClustalW. الأحماض الأمينية المتطابقة مظللة والأحماض الأمينية المتشابهة تفقس بظل الصندوق. تشير العلامات النجمية إلى مواضع الأحماض الأمينية التي تم تغييرها بواسطةsld3-10, -41، و -52الطفرات كما هو موضح في النص.

لقد استبدلنا أحد sld3 + نسخ في ملفيورا - ثنائي الصبغة معsld3 :: ura4 +. أبواغ وتشريح رباعي للsld3 + / sld3 :: ura4أسفرت المادة غير المتجانسة عن جراثيم قابلة للحياة واثنين من الأبواغ القاتلة وجميع الأبواغ القابلة للحياة كانت Ura -. للتأكد من أن الفتك كان بسبب تعطيلsld3 + ، الsld3 + /sld3 :: ura4 + ثنائية الصبغيات المحولة مع pSLD3 البلازميد الذي يحملsld3 + الجين أبوغ. أسفر تشريح تتراد عن ثلاثة وأربعة جراثيم قابلة للحياة ، بما في ذلك جراثيم Ura +. وهكذا ، فإنsld3 + هو بالفعل ضروري لنمو الخلايا.

مسوخ sld3 الحساسة لدرجة الحرارة معيبة في نسخ الحمض النووي

لاستكشاف الدور الأساسي لـ Sld3 في نمو الخلايا ، قمنا بعزل المسوخات الحساسة للحرارة من sld3. تم إدخال الطفرات بواسطة PCR في جزء يحملsld3 + وura4 + تم استخدام الجينات ومنتجات PCR لتحويل a يورا - سلالة أحادية العدد. من بين 3000 من محولات Ura + التي نمت عند 23 درجة مئوية ، تم عزل ثلاثة طفرات لم تنمو عند 36 درجة مئوية. تمت استعادة نمو المسوخ عند درجة الحرارة المقيدة بالتحول مع pSLD3 ، مما يشير إلى أن sld3الجين لديه الطفرات.

تحديد تسلسل النوكليوتيدات للطفرة sld3كشفت الجينات أن بقايا حمض الجلوتاميك في الموضع 338 يتم استبدالها بالجليسين في sld3-10، التربتوفان في الموضع 310 مع أرجينين في sld3-52، والسيرين في الموضع 153 والليوسين في الموضع 309 مع الليوسين والبرولين ، على التوالي ، في sld3-41. وتجدر الإشارة إلى أن كل هذه التغييرات موجودة في مناطق الملف الملفوف المتوقعة ، على الرغم من أن هذه الأحماض الأمينية لا يتم حفظها بين الخميرة الناشئة Sld3 و SpSld3 ، باستثناء موقع واحد من موقعين في sld3-41 (الشكل 1 أ).

درسنا أولاً نمو sld3-10 في درجة الحرارة المقيدة. تم إعاقة الزيادة في عدد الخلايا خلال 2-4 ساعات عند 36 درجة مئوية وتم القبض عليها بعد 6 ساعات (الشكل 2 أ). انخفضت صلاحية الخلية إلى -40٪ في 6 ساعات (الشكل 2 ب). لتحديد آثار sld3-10طفرة على تكاثر الحمض النووي ، قمنا بتحليل محتويات الحمض النووي في درجة الحرارة المقيدة ، باستخدام قياس التدفق الخلوي. sld3-10الخلايا ، التي تحتوي في البداية على 2C DNA كنوع بري ، أنتجت خلايا تحتوي على 1C DNA بعد ساعتين عند 36 درجة مئوية وزاد عدد سكان هذه الخلايا في 4 ساعات (الشكل 2C). بالإضافة إلى ذلك ، ظهرت الخلايا التي تحتوي على محتوى DNA & lt1C في 6 ساعات. الطافرتان الأخريان ،sld3-41 و sld3-52، تراكمت أيضًا خلايا بها محتوى DNA 1C عند درجة الحرارة المقيدة (بياناتنا غير المنشورة). لذلك ، لا يتم تكرار الحمض النووي للكروموسوم في هذه الطفرات. يبدو أن SpSld3 مطلوب لتكرار الحمض النووي أو لتقدم G1-S لدورة الخلية.

الشكل 2. نمو حساس لدرجة الحرارة sld3-10. النوع البري المتنامي باطراد (972) و sld3-10 تم تحويل الخلايا عند 23 درجة مئوية إلى 36 درجة مئوية وتم تحليل الخلايا التي تم جمعها في النقاط الزمنية المحددة. يتم عرض رقم الخلية (A) وصلاحية الخلية (B). (ج) يتم عرض ملامح قياس التدفق الخلوي. (د) قمع sld3-10 بجرعة جينية مرتفعة من sna41 + معروض. ال sld3-10 تم تحديد الخلايا المحولة باستخدام ناقل ، pSLD3 ، أو pSNA41 بلازميد على ألواح EMM2 وحضنت عند 23 أو 36 درجة مئوية. (ه) قمع sna41-1 بواسطةsld3 + معروض. النمو اللوغاريتمي sna41-1 تم رصد الخلايا التي تحمل ناقل ، pSNA41 ، أو pSLD3 البلازميد بعد التخفيفات التسلسلية وحضنت عند 25 أو 37 درجة مئوية.

مع تلطيخ 4،6-Diamidino-2-phenylindole ، لاحظنا أن ∼10 ٪ منsld3-10 تحتوي الخلايا على نواة مقسمة بشكل غير متساو أو نواة غير مقسمة مشقوقة بواسطة الحاجز بعد 6 ساعات عند 36 درجة مئوية ، ومع ذلك لم يتم ملاحظة هذه الخلايا في النوع البري (بياناتنا غير المنشورة). تتوافق هذه الخلايا مع الخلايا التي تحتوي على & lt1C من محتوى DNA في تحليل قياس التدفق الخلوي ، ويفترض أنها تتشكل نتيجة للانقسام النووي دون إكمال تكرار الحمض النووي. تشير هذه النتائج إلى أن ملف sld3-10 الخلايا بها عيب في توليد إشارة نقطة تفتيش S-M.

في مهدها الخميرة SLD3 لديه تفاعل وراثي معSLD4/CDC45 (كاميمورا وآخرون.، 2001). للتحقيق في مثل هذا التفاعل بينsld3 + و الsna41 + ترميز الجينات SpCdc45 ،sld3 تم تحويل المسوخات بحمل بلازميد عالي النسخ sna41 + . النمو لsld3-10, -41، و -52 في درجة الحرارة المقيدة تم استعادتها بواسطةsna41 + البلازميد (الشكل 2D بياناتنا غير المنشورة). في تجربة متبادلة ، نمو sna41-1، متحولة حساسة لدرجة الحرارة من sna41، عن طريق التحول مع pSLD3 (الشكل 2E). لذلك ، توجد تفاعلات جينية قوية بين sld3 + وsna41 +. مع تشابه التسلسل ، sld3 + يبدو أنه نظير للخميرة في مهدها SLD3.

التفاعلات المعتمدة على دورة الخلية لـ SpSld3 مع SpCdc45 و SpMcm6

بناءً على التفاعلات الجينية بينsld3 + وsna41 + ، قمنا بفحص التفاعلات المادية بين SpSld3 و SpCdc45. تم القبض على الخلايا التي تعبر عن SpCdc45-Myc أو كلاهما SpCdc45-Myc و SpSld3-FLAG من مواقع الكروموسوم في المرحلة S المبكرة عن طريق إضافة هيدروكسي يوريا (HU) ، مما يثبط تخليق ديوكسي ريبونوكليوتيد. تم تحصين SpSld3 في وجود DNase I وهذا من شأنه أن يقلل من الترسيب المشترك غير المحدد بوساطة الحمض النووي. تم ترسيب SpCdc45 من الخلايا التي تعبر عن SpSld3-FLAG (الشكل 3 أ ، الممر 6) ، ولكن ليس من السلالة غير المميزة (الممر 3) أو بدون الجسم المضاد لـ FLAG (الممر 5). في تجربة متبادلة باستخدام جسم مضاد لـ SpCdc45 ، تشارك SpSld3-FLAG مع SpCdc45 (الشكل 3 أ ، الممر 8). تعني هذه الملاحظات أن SpSld3 يرتبط بـ SpCdc45 في مرحلة S.

التين. 3. Coimmunoprec ترسيب لـ SpCdc45 و SpMcm6 مع SpSld3 في مراحل G1-S. (أ) الخلايا التي تعبر عن كل من SpSld3-FLAG5 و SpCdc45-Myc9 (الممرات 4-6 و 7 و 8) أو فقط SpCdc45-Myc9 (الممرات 1-3) تمت تربيتها في وجود 10 ملي مولار لمدة 3 ساعات عند 30 درجة مئوية لاعتقاله في أوائل المرحلة S. تم تحضير مستخلصات الخلايا الكاملة (الممران 1 و 4) وتعريضهما للترسيب المناعي مع الأجسام المضادة لـ FLAG (الممران 3 و 6) ، والعلاج الوهمي بدون الأجسام المضادة (الممران 2 و 5) ، مع مصل الأرانب الطبيعي (الخط 7) ، أو مضاد الجسم المضاد SpCdc45 (الممر 8). تم استخدام نشافات مناعية أكثر بعشر مرات مقارنة مع المدخلات من أجل النشاف الغربي باستخدام الأجسام المضادة لـ FLAG والأجسام المضادة لـ Myc. لم نكتشف SpSld3-FLAG بدون ترسيب مناعي ، ربما لأن الكمية كانت أقل من حدود الكشف. (ب) مؤتمر نزع السلاح 25-22 تم القبض على الخلايا التي تعبر عن SpSld3-FLAG5 و SpCdc45-Myc9 لمدة 4 ساعات عند 36 درجة مئوية ثم تم إطلاقها عند 25 درجة مئوية. في النقاط الزمنية المحددة ، تم ترسيب المستخلصات بأجسام مضادة لـ FLAG. تم تحليل SpSld3-FLAG و SpMcm6 و SpCdc45 في الراسبات المناعية عن طريق التكتل المناعي. تمت مراقبة تقدم دورة الخلية من خلال النسبة المئوية للخلايا التي تحتوي على الحاجز (مؤشر الفصل) ، كما هو موضح أسفل الألواح. في الخميرة الانشطارية ، يحدث التحلل الخلوي بعد ربع دورة الخلية بعد الانقسام النووي (Alfa وآخرون.، 1993). وبالتالي ، يصبح مؤشر الفصل بحد أقصى تقريبًا عند الانتقال G1-S في الخلايا البرية ، في ظل الظروف التي استخدمناها. (C) SpSld3 كان مناعيًا باستخدام جسم مضاد لـ FLAG من nda3-KM311 sld3-flag5 الخلايا المستزرعة لمدة 4 ساعات عند 20 درجة مئوية (الممرات 1-4). تمت معالجة الراسبات المناعية باستخدام CIP في وجود (الممرات 4) أو عدم وجود (الممرات 3) لمثبطات الفوسفاتيز.

بعد ذلك ، قمنا بفحص ارتباط SpSld3 بـ SpCdc45 أثناء دورة الخلية. حساس لدرجة الحرارة مؤتمر نزع السلاح 25-22 تم القبض على الخلايا التي تعبر عن SpSld3-FLAG و SpCdc45-Myc عند حدود G2 / M وتم إطلاقها في دورة الخلية عند درجة الحرارة المسموح بها. أظهرت تحليلات SpSld3-immunoprecipitates (IPs) عن طريق النشاف الغربي أن SpCdc45 تعاطت 80-120 دقيقة بعد الإطلاق (الشكل 3 ب). كان توقيت الهطول المشترك بعد فترة وجيزة من الزيادة في مؤشر الفصل ، مما يشير إلى أن SpSld3 يرتبط بـ SpCdc45 بشكل رئيسي في المرحلة S. من ناحية أخرى ، تم اكتشاف SpMcm6 في SpSld3-IPs في 60-100 دقيقة ، مثل أقدم من SpCdc45. شارك SpMcm7 أيضًا مع SpSld3 خلال نفس الفترة مثل SpMcm6 (بياناتنا غير المنشورة). ربما يرتبط SpSld3 ببروتينات MCM قبل الارتباط بـ SpCdc45.

تم ترحيل SpSld3 كنطاقات منتشرة خلال 0-60 دقيقة بعد التحرير من كتلة G2 / M ، في حين أنها شكلت نطاقًا حادًا مع قدرة تنقل أعلى عند 80 دقيقة ونقاط زمنية لاحقة. لفحص احتمال أن يكون التنقل الأبطأ لـ SpSld3 بسبب الفسفرة ، تم تحصين SpSld3 من nda3-KM311 sld3-flag5 الخلايا التي تم القبض عليها في المرحلة M (Hiraoka وآخرون.، 1984) مع CIP. أسفر علاج الفوسفاتيز هذا عن نطاق حاد مع قدرة أعلى على الحركة (الشكل 3 ج ، الممر 3) ، بينما ظلت العصابات المهاجرة ببطء في وجود مثبطات الفوسفاتيز (الشكل 3 ج ، الممر 4). وهكذا ، يتم فسفرة SpSld3 في الخلايا المحجوزة في الطور M. يبدو أن النطاق الأعلى للتنقل الذي لوحظ خلال المرحلة S (الشكل 3 ب) هو نموذج تحت الفسفرة.

توطين SpSld3 في أصل النسخ المتماثل للكروموسومات خلال مراحل G1-S

يتم ترجمة SpMcm6 إلى أصل النسخ المتماثل خلال مراحل G1-S (Ogawa وآخرون.، 1999). نظرًا لأن SpSld3 يرتبط بـ SpMcm6 ، فقد سألنا عما إذا كان SpSld3 مرتبطًا بأصل النسخ المتماثل أثناء مرحلة معينة من دورة الخلية. قمنا بإجراء فحوصات الكروماتين ChIP (Ogawa وآخرون.، 1999) باستخدام مؤتمر نزع السلاح 25-22 الخلايا التي تعبر عن SpSld3-FLAG ، متزامنة كما هو موضح أعلاه. تم ربط الخلايا مع الفورمالديهايد في النقاط الزمنية المحددة وتم استرداد شظايا الحمض النووي المرتبطة بـ SpSld3-FLAG عن طريق الترسيب المناعي. تم تحليل ارتباط SpSld3 بواسطة PCR لأصل تكرار الكروموسومات ars2004 (أوكونو وآخرون.، 1997) ، جنبًا إلى جنب مع منطقتين خارج نطاق ARS. تم تضخيم الأجزاء الثلاثة إلى حد مماثل من الحمض النووي الخلوي الكلي المستخدم كقالب (الشكل 4 أ). من ناحية أخرى ، عندما تم استخدام الحمض النووي المناعي كقالب ، فإنars2004 تم تضخيم الجزء بشكل تفضيلي خلال 80-120 دقيقة بعد الإصدار (الشكل 4 أ) وتتوافق هذه الفترة مع مراحل G1-S التي تمت مراقبتها من خلال زيادة مؤشر الفصل. التضخيم التفضيلي لـ ars2004 يعتمد الجزء على SpSld3 الموسوم بعلامة FLAG وعلى العلاج المتقاطع (بياناتنا غير المنشورة). هذه الملاحظات تعني أن SpSld3 يرتبط بـars2004 الأصل خلال مراحل G1-S.

الشكل 4. SpSld3 يرتبط مع الأصل DNA في مراحل G1-S. (أ) مؤتمر نزع السلاح 25-22 تمت مزامنة الخلايا التي تعبر عن SpSld3-FLAG5 و SpCdc45-Myc9 ، كما هو موضح في الشكل 3 ب. في كل 20 دقيقة ، تم إصلاح الخلايا باستخدام شظايا الفورمالديهايد والحمض النووي المرتبطة بـ SpSld3-FLAG وتم تحصينها بأجسام مضادة لـ FLAG. ال ars2004 تم تضخيم المناطق غير التابعة لـ ARS من الحمض النووي الخلوي الكلي (المجموع) والحمض النووي المتسرب مناعيًا باستخدام ars2004 واثنين من مجموعات التمهيدي غير ARS وتعرضوا ل [اغروس) هلام التفريد. تظهر النسب المئوية للخلايا التي تحتوي على الحاجز أسفل اللوحة. (ب) cdc10-v50 sld3-flag5 تم تحضين الخلايا التي نمت عند 23 درجة مئوية لمدة 3 ساعات عند 36 درجة مئوية. تعرضت الخلايا للترسيب المناعي للكروماتين مع الأجسام المضادة لـ FLAG كما هو موصوف أعلاه. يتم عرض ملفات تعريف التدفق الخلوي عند 0 و 3 ساعات (على اليسار). (ج) hsk1-89 sld3-flag5 تم نقل الخلايا إلى 30 درجة مئوية واحتضانها لمدة 3 ساعات. تعرضت الخلايا للترسيب المناعي للكروماتين مع الأجسام المضادة لـ SpMcm6 أو الجسم المضاد لـ FLAG. يُظهر ملف قياس التدفق الخلوي أن حوالي نصف الخلايا تحتوي على DNA غير متماثل (على اليسار).

لفحص توقيت ارتباط أصل SpSld3 بشكل أكثر دقة ، قمنا بإجراء فحوصات ChIP باستخدام مؤتمر نزع السلاح 10 سلالة لا يتم فيها التعبير عن Cdc18 أو Cdt1 ولا يتم تحميل بروتينات MCM على الكروماتين عند درجة الحرارة المقيدة (Ogawa وآخرون.، 1999 نيشيتاني وآخرون., 2000). cdc10-V50 تم تحضين الخلايا التي تعبر عن SpSld3-FLAG عند 36 درجة مئوية لمدة 3 ساعات لإيقاف دورة الخلية في مرحلة G1 المبكرة. ال ars2004 لم يتم تضخيم جزء بشكل تفضيلي من المناعية من SpSld3 (الشكل 4 ب). للتحقق من عمل مقايسة ChIP للخلايا المحتضنة في درجة حرارة عالية ، مؤتمر نزع السلاح 25-22 تم إلقاء القبض على الخلايا التي تم إطلاقها من حدود G2 / M في المرحلة S المبكرة في وجود HU ، ثم تم تحضينها عند 36 درجة مئوية لمدة ساعة واحدة. الars2004 تم تضخيم جزء بشكل انتقائي من مناعي الحمض النووي باستخدام SpSld3 إلى حد مماثل للعينة غير المحتضنة عند 36 درجة مئوية (بياناتنا غير المنشورة). تشير هذه النتائج إلى عدم تحميل SpSld3 على أصل النسخ المتماثل فيمؤتمر نزع السلاح 10- نقطة الاستراحة في المرحلة G1.

قمنا بعد ذلك بفحص ارتباط أصل SpSld3 بتنسيق hsk1-89متحولة ، متحولة حساسة لدرجة الحرارة لـ Hsk1 kinase (Takeda وآخرون.، 2001). تم الإبلاغ عن أن نشاط DDK غير مطلوب لتحميل الكروماتين لـ MCM ولكنه مطلوب لتحميل Cdc45 فيXenopus مستخلصات البيض (جاريس أند بلو ، 2000 والتر ، 2000). وهكذا ، في hsk1-89 الخلايا ، من المتوقع أن تتوقف دورة الخلية قبل البدء ، في أواخر المرحلة G1. hsk1-89 تم تحضين الخلايا المتحولة التي تعبر عن SpSld3-FLAG عند درجة حرارة مقيدة (30 درجة مئوية) لمدة ساعتين ثم خضعت لاختبار ChIP. الars2004 تم تضخيم الجزء بشكل تفضيلي من SpMcm6-IPs (الشكل 4C) ، مما يؤكد أن DDK غير مطلوب لتحميل مليون متر مكعب في الخميرة الانشطارية. التضخيم المحددars2004 لم يلاحظ جزء باستخدام SpSld3-IPs كقالب (الشكل 4C). لأن نشاط DDK يتم تقليله بواسطةhsk1-89 طفرة (تاكيدا وآخرون.، 2001) ، يعتمد ارتباط SpSld3 بأصل النسخ المتماثل على نشاط DDK. يقترن SpSld3 بالأصول في أواخر مرحلة G1 ، بعد أو عند نقطة تنفيذ DDK.

تم إعاقة تحميل الكروماتين لـ SpCdc45 بسبب طفرة sld3-10

لتحديد دور SpSld3 في بدء تكرار الحمض النووي ، قمنا بالتحقيق فيما إذا كان sld3-10 ستؤثر الطفرة على تحميل MCM و SpCdc45 على الكروماتين. درسنا أولاً ارتباط بروتينات MCM و SpCdc45 مع الكروماتين في تقدم دورة الخلية. كنا مؤتمر نزع السلاح 25-22 تمت مزامنة الخلايا التي تعبر عن SpCdc45-Myc و SpSld3-FLAG كما هو موضح أعلاه. في النقاط الزمنية المحددة ، تم فصل الجزء المخصب بالكروماتين عن جزء البروتين القابل للذوبان وتم تحليله بواسطة النشاف الغربي. كما هو مبين في الشكل 5 أ ، كانت SpOrc4 ، وهي وحدة فرعية من SpORC ، موجودة في الجزء المخصب بالكروماتين طوال دورة الخلية. ارتبط SpMcm6 بالكروماتين من 40 إلى 120 دقيقة بعد الإطلاق ، وهو ما يتوافق مع مراحل G1-S. تم اكتشاف SpMcm7 في الجزء المخصب بالكروماتين خلال نفس الفترة مثل SpMcm6 (بياناتنا غير المنشورة). من ناحية أخرى ، ظهر SpCdc45 في الجزء المخصب بالكروماتين في 60 دقيقة ، وبلغ ذروته في 80-100 دقيقة بعد الإطلاق ، ثم تم تقليله (الشكل 5 أ). لذلك ، يرتبط SpCdc45 بالكروماتين في وقت متأخر عن بروتينات MCM. لم نكتشف SpSld3 في الجزء المخصب بالكروماتين أو في الجزء القابل للذوبان ، ربما لأن كميات البروتين في هذه الكسور كانت أقل من حدود الكشف (بياناتنا غير المنشورة).

الشكل 5. يتم تقليل ارتباط SpCdc45 مع الكروماتين في sld3-10 متحولة. (أ) يظهر الارتباط المعتمد على دورة الخلية لـ SpCdc45 مع الكروماتين. المؤتمر نزع السلاح 25-22 تمت مزامنة الخلايا التي تعبر عن SpSld3-FLAG5 و SpCdc45-Myc9 ، كما هو موضح في الشكل 3 ب.تعرضت الخلايا التي تم جمعها في الأوقات المحددة لتجزئة الكروماتين. تم تحليل المادة الطافية (S) والجزء المخصب بالكروماتين (P) عن طريق النشاف الغربي باستخدام الأجسام المضادة لـ SpMcm6 و anti-SpCdc45 و Anti-SpOrc4. يظهر مؤشر الفصل أسفل الألواح. (ب) البرية من النوع و sld3-10 نمت الخلايا التي تعبر عن SpCdc45-Myc9 و SpOrc1-FLAG5 لتسجيل الطور عند 23 درجة مئوية. الsld3-10 ثم تم تحضين الخلايا عند 36 درجة مئوية لمدة 3 ساعات. تم تحضين الخلايا البرية لمدة 3 ساعات عند 36 درجة مئوية في وجود 12 ملي مولار من أجل إيقافها في المرحلة S. يتم عرض نتائج قياس التدفق الخلوي. (ج) رابطة SpCdc45 مع الكروماتين فيsld3-10 تم فحصه. تعرضت Lysates لتجزئة الكروماتين. تم تحليل مستخلصات الخلايا الكاملة (WCE) والطاف (sup) والجزء المخصب بالكروماتين (ppt) عن طريق التجلط المناعي باستخدام مضاد FLAG (أعلى) ومضاد SpMcm6 ومضاد Myc (وسط) ومضاد Mcm7 (أسفل) الأجسام المضادة. (د) رابطة SpMcm6 مع SpCdc45 بوصة sld3-10 في درجة الحرارة المقيدة. البرية من نوع و sld3-10تم تحضين الخلايا عند 36 درجة مئوية كما هو الحال في B. تم تحصين الخلايا الخلوية بمصل الأرانب الطبيعي (mock IP) أو الجسم المضاد لـ SpMcm6. تم تحليل الراسبات المناعية عن طريق التجلط المناعي باستخدام الأجسام المضادة لـ SpMcm6 والأجسام المضادة لـ Myc.

لفحص تأثير sld3-10 طفرة عند ارتباط SpCdc45 بالكروماتين ، تم تحضين الخلايا الطافرة التي تعبر عن SpOrc1-FLAG و SpCdc45-Myc عند 36 درجة مئوية لمدة 3 ساعات. كعنصر تحكم ، تم القبض على الخلايا من النوع البري في المرحلة S المبكرة عن طريق الحضانة عند 36 درجة مئوية لمدة 3 ساعات في وجود HU. كشف قياس التدفق الخلوي أن السلالات من النوع البري المتحولة والمعالجة بجهاز HU قد تراكمت مع محتوى الحمض النووي 1C (الشكل 5 ب). أظهرت نتائج النشاف الغربي أن ما يقرب من ثلث SpOrc1 وعُشر كل من SpMcm6 و SpMcm7 و SpCdc45 كانت في الجزء المخصب بالكروماتين من الخلايا البرية التي تم إيقافها من قبل HU (الشكل 5C). في المقابل ، لم يتم اكتشاف SpCdc45 في الجزء المخصب بالكروماتين من sld3-10مقتطفات ، في حين تم الكشف عن SpOrc1 و SpMcm6 و SpMcm7 كنوع بري تم القبض عليه من قبل HU (الشكل 5C). لذلك ، فإن sld3-10متحولة لديها عيب في تحميل أو صيانة SpCdc45 على الكروماتين. تمشيا مع هذه النتائج ، لم يتفاعل SpCdc45 مع SpMcm6 عند درجة الحرارة المقيدة sld3-10(الشكل 5 د). تشير هذه النتائج إلى أن SpSld3 مطلوب لتحميل SpCdc45 على ما قبل RCs في أصول النسخ المتماثل.

متطلبات SpSld3 خلال المرحلة S.

لأن بروتينات MCM و Cdc45 مطلوبة لاستطالة تكرار الحمض النووي (لبيب وآخرون.، 2000 Tercero وآخرون.، 2000) ، قررنا ما إذا كان SpSld3 مطلوبًا بعد الدخول في المرحلة S. البرية من نوع و sld3-10 تم القبض على الخلايا بواسطة HU عند 23 درجة مئوية ثم حضنت عند 36 درجة مئوية لتعطيل البروتين الطافر. عند إزالة HU عند 36 درجة مئوية ، زاد محتوى الحمض النووي للخلايا البرية من 1 درجة مئوية إلى 2 درجة مئوية خلال 30 دقيقة (الشكل 6 ب). فى المقابل، sld3-10زادت الخلايا من محتوى الحمض النووي ببطء شديد بعد إطلاقها. على الرغم من أن محتوى الحمض النووي sld3-10 زادت الخلايا إلى ما يقرب من 2C DNA بعد 3 ساعات ، ولم يزداد عدد الخلايا (الشكل 6C) ، ربما بسبب عدم اكتمال تخليق الحمض النووي ، كما هو مقترح من الذروة العريضة التي شوهدت في نتائج قياس التدفق الخلوي. قد ينتج التخلف الشديد في تكرار الحمض النووي عن خلل في الاستطالة بالإضافة إلى خلل في بدء أصول إطلاق النار المتأخر ، والتي لم يتم تنشيطها في الخلايا الموقوفة من نوع HU. قد يكون الفقد التدريجي للصلاحية بعد الإفراج (الشكل 6 د) بسبب عيوب لا رجعة فيها في استطالة تكرار الحمض النووي مثل توليف الحمض النووي الشاذ.

الشكل 6. ينفصل SpCdc45 عن الكروماتين المحبوس على المرحلة S في sld3-10. (أ) البرية من النوع وsld3-10 تمت تربية الخلايا التي تعبر عن SpOrc1-FLAG5 و SpCdc45-Myc9 لمدة 4 ساعات في وجود 10 ملي مولار عند درجة الحرارة المسموح بها (23 درجة مئوية) ثم حضنت عند 36 درجة مئوية لمدة ساعة واحدة. تم غسل الخلايا وإعادة تعليقها في الوسط الكامل بدون HU. (أ) يظهر مخطط التجربة. (ب) تم تحليل محتويات الحمض النووي للخلايا بعد إطلاق سراحه من اعتقال هو عن طريق قياس التدفق الخلوي. يتم عرض أرقام الخلايا (C) والصلاحية التي تم الحصول عليها بواسطة وحدات تشكيل المستعمرة / رقم الخلية (D). (E) تم تحضير جزء الكروماتين من الخلايا الموقوفة من قبل HU قبل وبعد الحضانة لمدة ساعة واحدة عند 36 درجة مئوية. تم تحليل مستخلصات الخلايا الكاملة (W) ، والطاف (S) ، والجزء المخصب بالكروماتين (P) عن طريق التكتل المناعي باستخدام مضاد FLAG لـ SpOrc1-FL (أعلى) ، ومضاد SpMcm6 (وسط) ، والأجسام المضادة لـ Myc لـ SpCdc45 -Myc (أسفل). (F) تم قياس الصور في E باستخدام محلل الصور LAS1000 plus (Fuji Film ، طوكيو ، اليابان) ويتم تقديم نسب SpMcm6 / SpOrc1 و SpCdc45 / SpOrc1.

للتحقيق في دور SpSld3 خلال المرحلة S ، قمنا بفحص تأثيرات sld3-10 طفرة على استقرار ارتباط الكروماتين لبروتينات MCM و SpCdc45. في الخلايا البرية التي تم القبض عليها من قبل HU ، ظلت كميات SpOrc1 و SpMcm6 و SpCdc45 المرتبطة بالكروماتين دون تغيير بعد الحضانة اللاحقة عند 36 درجة مئوية لمدة ساعة واحدة (الشكل 6E ، الممر 6). في المقابل ، في sld3-10 الخلايا ، تم تقليل كمية SpCdc45 المرتبطة بالكروماتين عن طريق الحضانة عند 36 درجة مئوية (الشكل 6E ، الممر 12). لم تتأثر كمية SpMcm6 في جزء الكروماتين بشكل كبير ، كما يتضح من القياس الكمي للإشارات المناعية (الشكل 6F). تظهر هذه النتائج أن SpSld3 مطلوب لصيانة SpCdc45 على الكروماتين أثناء المرحلة S.


نتائج

تصميم تجريبي لاكتشاف انقسام تيترامر في مواقع جينومية مميزة.

يستخدم إعدادنا التجريبي نسختين من H3 ذات علامات تفاضلية ، موضوعة تحت مروّجات محفّزة ويتم تنظيمها لتكوين هيستونات قديمة وجديدة (الشكل 1).أ). يحتوي H3 القديم على ثلاث نسخ من البروتين السكري VSV (H3 – VSVG) ويتم التعبير عنه من MET3 المروج ، بينما H3 مع علامتي HA (H3 – HA) ، يتم التعبير عنها من GAL1 المروج ، وظائف هيستون الجديد. تم إدخال البلازميدات التي تحتوي على كل نسخة من H3 المحرض ذي العلامات الطرفية C معًا في S. cerevisiae سلالة تفتقر إلى الجينات الذاتية لـ H3. كل نسخة مميزة من H3 قادرة على دعم القابلية للتطبيق عندما يتم التعبير عنها على أنها النسخة الوحيدة من H3 ، مما يؤكد وظيفتها. تم إنشاء سلالة تحكم إيجابية إضافية ، حيث يكون كلا النسختين الموسمتين من H3 تحت سيطرة المروج الأصلي وبالتالي متعايشين (الشكل 1).ب).

تصميم تجريبي. (أ) تفتقر السلالة التجريبية YKY69 إلى جينات H3 الذاتية وتحتوي على اثنين من البلازميدات المركزية تعبر عن H3 – VSVG من الميثيونين القابل للقمع MET3 المروج و H3 – HA من المحفز الجالاكتوز GAL1 المروجين. (ب) سلالة التحكم YKY64 مشابهة لـ YKY69 ، فيما عدا أن النسختين المعلمتين من H3 تخضعان لسيطرة النسخة الأصلية HHT2 المروج ، مما أدى إلى تعايشهم. (ج) تزرع خلايا YKY69 في البداية في وسط يفتقر إلى الميثيونين وتحتوي على رافينوز ، مما يؤدي إلى التعبير عن H3-VSVG فقط (هيستون "القديم"). يضاف الميثيونين لمدة 4.5 ساعة لقمع MET3 المروج وإنهاء تعبير H3-VSVG (عينة أ). ثم يتم معالجة الخلايا بالجلاكتوز للحث على تعبير H3-HA (هيستون "جديد") لمدة 2.5 ساعة و 4.5 ساعة و 6.5 ساعة (عينات B و C و D على التوالي). تتكون العينة E من خلايا YKY69 التي نمت لمدة 20 ساعة في وسط يحتوي على كل من الميثيونين والجلاكتوز ، مما أدى إلى التعبير عن H3-HA. (د) إجراء لأداء رقاقة متسلسلة من وحيدة النواة.

نمت السلالة التجريبية في البداية في غياب الميثيونين ، لتحفيز MET3 المروج ، مما أدى إلى التعبير عن H3 – VSVG القديم (الشكل 1ج). نظرًا لاستخدام رافينوز كمصدر للكربون ، فإن GAL1 ظل المروج الذي ينظم H3-HA غير مستحث في هذا الوقت. لقمع MET3 محفز وإنهاء تعبير H3 – VSVG ، تمت إضافة الميثيونين ، والسماح للخلايا بالنمو لمدة 4.5 ساعة ، أي ما يقرب من جيل. بعد هذه الفترة من MET3 قمع المروج ، تمت إضافة الجالاكتوز للحث على GAL1 المروج وبالتالي بدء تخليق H3-HA الجديد. تم أخذ عينات للتحليل قبل (التحكم السلبي) مباشرة وعند 2.5 ساعة و 4.5 ساعة و 6.5 ساعة بعد إضافة الجالاكتوز. كعنصر تحكم سلبي آخر ، نمت الخلايا بين عشية وضحاها في وجود الميثيونين والجالاكتوز تمثل الحالة التي يتم فيها تحفيز H3-HA الجديد فقط.

كانت التجربة الحاسمة هي إجراء ChIP متسلسل (25) على أحاديات النواة المعزولة من العينات المختلفة. على وجه التحديد ، تمت معالجة الكروماتين المتشابك بالفورمالديهايد باستخدام نوكلياز المكورات الدقيقة لإنتاج شظايا كروماتين بحجم أحادي النواة بشكل أساسي ، والتي خضعت لخطوتين من الترسيب المناعي للحصول على شظايا الحمض النووي المرتبطة بكل من VSVG- و HA الموسوم H3 (الشكل 1).د). بعد انعكاس الروابط المتشابكة ، تم فصل الحمض النووي من التساقط المناعي الفردي والمتسلسل والمدخلات على هلام ، وتم عزل شظايا الحمض النووي أحادية النواة وتحليلها بواسطة PCR الكمي. للتحكم في الاختلافات في استعادة العينة ، تم خلط الحمض النووي بكمية منخفضة ثابتة من DNA البلازميد غير الخمري المهضوم قبل تنقية الهلام تم استخدام إشارات PCR من جزء 148 نقطة أساس مولدة بالبلازميد للتطبيع.

تجارب التحكم.

وفقًا للتصميم التجريبي ، نلاحظ مستوى مرتفعًا مبدئيًا من H3-VSVG القديم قبل تحريض الجالاكتوز (الشكل 2).أ، العينة أ) ، متبوعًا بخسارة تدريجية (العينات من B إلى E). في المقابل ، كانت مستويات H3-HA الجديدة منخفضة جدًا في البداية (الشكل 2ب، العينة أ) وتزداد طوال الوقت (العينات من B إلى E). يتم استكمال الفقد الأسرع لـ H3 – VSVG القديم في بعض المواقع من خلال الدمج السريع لـ H3-HA الجديد ، وهذا متوقع من المعدلات الأعلى لتبادل هيستون المستقل عن النسخ المتماثل في الجين النشط ORFs والمروجين (14-16) . تشمل هذه المناطق الديناميكية ذات أسعار الصرف العالية للنيوكليوسومات PMA1 (+337)، تليها RPL3 (+492). لوحظ تبادل متواضع في FLO1 (−130), PHO5 (+56)، و ASC1 (+87). على الرغم من هذه الاختلافات في معدل دمج H3-HA ، فإن أكثر المواقع الثابتة (هاتف TELVI-R و POL1) تظهر ارتباطًا جوهريًا بنسبة 30٪ و 50٪ و 75٪ من المستويات النهائية عند 2.5 ساعة و 4.5 ساعة و 6.5 ساعة على التوالي. يجب أن تمكن دورة وقت الاستقراء هذه من اكتشاف رباعي رباعي مختلط محتمل في المواقع المختلفة. في سلالة التحكم الإيجابية التي يتم فيها تعايش H3 – VSVG و H3 – HA من محفز H3 الأصلي ، تم دمج كلا مشتقَي H3 الموسومين بمستويات عالية (الشكل 2). أ و ب، عينة و).

رابطة H3 القديمة والجديدة في مواقع مختلفة. تمت معالجة خلايا YKY69 للحث على تعبير H3-VSVG "القديم" ، متبوعًا بقمعه ، ثم تحريض تعبير H3-HA "الجديد" ، كما هو موضح في الشكل 1.ج. في العينات A و E ، تم تحفيز شكل H3 واحد فقط ودمج بشكل كبير (VSVG- و HA ، على التوالي) ، بينما احتوى كروماتين العينات B-D على كلا الشكلين H3 ، مدمجين في أوقات مختلفة. تمثل العينة F سلالة التحكم YKY64 ، التي تتعايش مع شكلي H3 المميزين من المروج الأصلي. توضح الرسوم البيانية متوسط ​​نتائج تحليل ChIP باستخدام VSVG (أ) أو HA (ب) الأجسام المضادة. تم تحليل إشغال H3 في موضع تيلومري (هاتف TELVI-R) وستة جينات مختلفة ، مع الإشارة إلى المواضع المتعلقة بموقع بدء الترجمة.

عموما القليل من الخلط بين القديم والجديد H3 في نفس النيوكليوسوم.

تم استخدام ChIP المتسلسل على mononucleosomes لتحديد الترابط النووي لـ H3 – VSVG و H3 – HA في مواضع جينية مختلفة أثناء الدورة الزمنية لتحريض الجالاكتوز (الشكل 3). عندما يتم التعبير عنهما من مروج H3 الأصلي (أي عينة سلالة التحكم الإيجابي F) ، يُظهر مشتقا H3 قيم تعايش عالية تتجاوز بكثير تلك التي شوهدت عندما تم إحداث نسخة H3 واحدة فقط (عينات التحكم A و E). هذا يؤكد قدرتنا على اكتشاف وجود اثنين من مشتقات H3 داخل نفس النواة (أي ، رباعي H3 - H4 مختلط) على مدى ديناميكي كبير. عينة E ، حيث لا يوجد سوى ملف GAL1 المحفز ، يظهر مستويات تشغل أعلى من العينة A ، بسبب التعبير المتبقي لـ H3 – VSVG من المكبوت MET3 المروجين. وهكذا تم أخذ قيم التزاوج للعينة E كخلفية تجريبية ، وتم تسجيل قيم أعلى بشكل ملحوظ فقط كإشارات إيجابية ناتجة عن تشابك H3-VSVG و H3-HA المستحث.

التعايش النووي مع H3 القديم والجديد. عينات من التجارب الموصوفة في التين. 1ج و 2 تعرضوا لجولتين من الترسيب المناعي باستخدام الأجسام المضادة VSVG و HA. تُظهر الرسوم البيانية متوسط ​​نتائج تحليل ChIP المتسلسل ، بالنسبة لقيم عينة الحث الفردي E ، التي تُعتبر خلفية تجريبية. تم تحليل تعايش H3 في موضع تيلومري (هاتف TELVI-R) وستة جينات مختلفة ، مع الإشارة إلى المواضع المتعلقة بموقع بدء الترجمة.

على النقيض من الترابط العالي بين H3 – VSVG و H3 – HA عندما يتم التعبير عنهما معًا ، فإن نفس البروتينات المعبر عنها بالتسلسل مثل أشكال H3 القديمة والجديدة تُظهر مستويات تعايش منخفضة عمومًا (عينات B-D). وبالتالي ، فإن H3 القديم والجديد ، الذي تم تقييمه في سبعة مواضع جينومية مختلفة ، لا يتواجدان بشكل متكرر داخل نفس النواة. تشير هذه البيانات إلى أن معظم أحداث دمج H3 في جينوم الخميرة لا تنطوي على تقسيم رباعي.

خلط H3 - H4 Dimers ضمن مناطق التبادل الهستوني الديناميكي.

بينما لا يتم اكتشاف مستويات تعايش H3 القديم والجديد في الغالب فوق الخلفية التجريبية ، تظهر بعض المواقع قيمًا أعلى بشكل واضح. من هؤلاء ، يتم الحصول على أعلى القيم في PMA1 (+337) عند 2.5 ساعة و 4.5 ساعات و 6 ساعات (ص- القيم & lt 0.01 ، & lt 0.005 ، & & lt 0.025 ، على التوالي ، بواسطة Welch’s unpaired ر-test) ، متبوعًا بـ RPL3 (+492) عند 2.5 ساعة و 4.5 ساعة (& lt 0.05 و & lt 0.025) ، ثم PHO5 (+56) عند 4.5 ساعة (& lt 0.025). ومن المثير للاهتمام ، أن مستويات المشاركة في المواقع المختلفة ترتبط عمومًا بسعر الصرف النووي. لوحظت أعلى مستويات المشاركة في التبادل بأسرع ما يمكن PMA1 (+337) locus ، وتصل إلى ما يقرب من 25 ٪ من المستوى الذي يُرى عند تضافر أشكال H3 ذات العلامات المختلفة (بعد طرح الخلفية التجريبية). وبالتالي ، تحدث مستويات كبيرة من الانقسام الرباعي في النيوكليوزومات عالية الديناميكية.

من حيث المبدأ ، تعكس قياسات التعايش ببساطة مستويات رباعي H3 - H4 المختلط في كل منطقة جينومية. على هذا النحو ، سيعتمد التعايش على المستويات النسبية لمشتقات H3 في موضع معين في وقت معين ، ولكن لا ينبغي أن يعتمد على معدل تبادل هيستون في حد ذاته. بالنسبة لموضع معين ، يجب أن يحدث الحد الأقصى من التعايش عندما يكون كل من مشتق H3 موجودًا عند 50٪ من المستوى الأقصى ، وسوف تنخفض التعايش تدريجيًا حيث تكون مستويات الارتباط لمشتقات H3 الفردية أكثر تعارضًا. وبالتالي ، فإن أفضل مقارنة لقيم المشاركة بين المواقع المختلفة تتضمن قياسات حيث يكون الارتباط النسبي لمشتقات H3 متشابهًا ، بدلاً من القياسات في نقطة زمنية واحدة. على سبيل المثال ، التشارك الواضح في الديناميكية PMA1 يُلاحظ الموضع عند 2.5 ساعة ، عندما يصل مستوى H3-HA الجديد إلى 83 ٪ من الارتباط الكامل. ومع ذلك ، فإن المواقع الأخرى التي تُظهر دمج H3-HA مشابهًا في أوقات لاحقة (على سبيل المثال ، POL1, ASC1، و FLO1) ليس لديهم نفس مستويات المشاركة. بشكل عام ، تتحقق شروط فحص الحد الأقصى من التعايش في جميع المواقع ، ومع ذلك لا يُلاحظ التعايش إلا في الجينات النشطة (الشكل 3) ، والتي تُظهر معدلات عالية من تبادل H3 (الشكل 2). وبالتالي ، يحدث الانقسام الرباعي بشكل تفضيلي في الجينات النشطة نسبيًا ويرتبط جيدًا بتبادل هيستون الديناميكي.

لمزيد من دراسة العلاقة بين سعر صرف هيستون وخلط H3 القديم والجديد ، قمنا بتحليل سبعة مواقع إضافية في الجينات التي من المتوقع أن تكون منخفضة (STL1 و GRE2) أو مرتفع (TEF1, ENO2، و PYK1) مستويات التعبير في ظل ظروفنا التجريبية. تختلف هذه المواقع في سعر صرف H3 الخاص بها ، كما يتضح من التأسيس الجديد H3-HA عند 2.5 ساعة ، مع STL1 (+1297) و GRE2 (+682) كونها أقل ديناميكية ، كما هو متوقع (الشكل 4أ). في الثلاثة ENO2 تم تحليل المواقف ، ترتبط مستويات دمج H3-HA مع قربها من موقع بدء الجين. كما هو مبين في الشكل 4ب، تعايش H3-VSVG و H3-HA عند 2.5 ساعة و 4.5 ساعة من تحريض الجالاكتوز (العينات B و C) بالنسبة للخلفية التجريبية (عينة الحث الفردي E) يزداد بالتوافق مع الزيادة في معدل H3-HA مستويات التأسيس (الشكل 4أ). وهكذا ، لوحظت مستويات قريبة من التعايش في الخلفية الثابتة نسبيًا STL1 (+1297), GRE2 (+682)، و ENO2 (توقف) loci ، تليها مستويات أعلى في أكثر ديناميكية ENO2 (+970)، وحتى المستويات الأعلى في أكثر المواقع ديناميكية TEF1 (+68), ENO2 (+88)، و PYK1 (+245). تشير هذه النتائج أيضًا إلى أنه في حين أن الانقسام الرباعي هو حدث نادر بشكل عام ، إلا أنه أكثر انتشارًا في مناطق التبادل النووي العالي ، مما ينتج عنه مستويات كبيرة من tetramers المختلطة المكونة من الهيستونات القديمة والجديدة.

الإشغال النووي والتعايش مع H3 المحرض في المواقع النشطة وغير النشطة. عينات رقاقة مفردة ومتسلسلة من تجارب التين. تم تحليل 1 و 2 و 3 للارتباط في مواقع إضافية. توضح الرسوم البيانية متوسط ​​نتائج (أ) تحليل ChIP باستخدام الأجسام المضادة لـ HA ، كما هو موضح في الشكل 2ب، أو (ب) رقاقة متسلسلة باستخدام الأجسام المضادة VSVG و HA ، كما هو موضح في الشكل 3. تم تحليل شغل H3 في جينات مختلفة ، مع المواضع المتعلقة بموقع بدء الترجمة أو حول كود الإيقاف (قف) مبين.


مناقشة

تورط ROS في ظهور وتطور الشذوذ الجيني ، ومع ذلك فقد تناولت دراسات قليلة آثارها على دورة الخلية ونقاط فحص الحمض النووي. نظهر هنا أن التعرض لتركيزات منخفضة من H.2642ا2 يؤخر تقدم دورة الخلية في G1، S و G2 مراحل ، ولكن يتم التحكم فقط في التأخير الذي يحدث في المرحلة S بواسطة نقاط فحص الحمض النووي. تمشيا مع هذه الملاحظة ، وجدنا أن الفسفرة Rad53 ناتجة عن H.2ا2 العلاج على وجه التحديد خلال المرحلة S. أخيرًا ، أظهرنا أن عدم وجود فسفرة Rad53 بعد H.2ا2 العلاج في G1 وج2 ترجع المراحل إلى الإصلاح الصامت بواسطة مسار BER لآفات الحمض النووي المؤكسدة التي تنتج في هذه المراحل.

يتم استشعار ضغوط الأكسدة شبه المميتة من خلال مسارات مراقبة الحمض النووي

الإجهاد التأكسدي تحت المميت الناجم عن تركيزات منخفضة من H22ا2 يتم اكتشافها بواسطة مسارات نقطة تفتيش الحمض النووي في الخميرة وتؤدي إلى استجابات تعتمد على Rad53. تثري هذه الملاحظات فهمنا للاستجابات الخلوية للإجهاد التأكسدي ويمكن أن يكون لها آثار مهمة على الأنظمة الأخرى. ترتبط الأمراض الوراثية البشرية ترنح الشعيرات الدموية وفقر دم فانكوني ومتلازمة بلوم ، التي تتميز بزيادة الإصابة بالسرطان ، أيضًا بخلل في استقلاب الأكسجين (روتمان وشيلوه ، 1997 للمراجعة انظر سيروتي ، 1985). علاوة على ذلك ، تبين أن أنواعًا عديدة من خطوط الخلايا السرطانية تتراكم مستويات عالية من H2ا2 (سزاتروفسكي وناثان ، 1991). من المتصور أن الحالات المؤيدة للأكسدة أو المستويات المتزايدة من الإجهاد التأكسدي الدائم المؤدي إلى تنشيط نقطة التفتيش المستمرة يمكن أن تحفز شكلاً من أشكال التكيف وتؤدي إلى خلل في أداء هذه المسارات ، مما يؤدي إلى استجابات غير طبيعية للإهانات السامة للجينات وتفضيل تكاثر الخلايا غير المنضبط.

التأخيرات التي يسببها بيروكسيد الهيدروجين في G1 وفي G2 مستقلة عن نقاط تفتيش الحمض النووي

لقد أثبتنا أن التأخير الناجم في المرحلة S فقط عن تركيزات منخفضة من H.2ا2 يعتمد على Rad53. الآليات المسؤولة عن التأخيرات التي تحدث في G1 وج2 مراحل بعد H.2ا2 يظل العلاج غير معروف ولكن يمكن أن تحدث بسبب تفاعلات خلوية بخلاف الهجمات التأكسدية على الحمض النووي. تم الإبلاغ عن العديد من العوامل غير السامة للجينات التي تسبب تأخيرات في G1. عند إضافة الجلوكوز إلى الخلايا التي تنمو في مصدر كربون فقير ، تتم إعادة ضبط حجم الخلية الحرج المطلوب لبدء التشغيل من حجم صغير إلى كبير من خلال تحفيز الجلوكوز لمسار Ras / cAMP ، مما يؤدي إلى قمع التعبير عن CLN1 ( نقرة وآخرون. ، 1998). وبالمثل ، تتسبب الصدمة الحرارية في تثبيط عابر لبدء التشغيل من خلال التناقص CLN1 و CLN2 النصوص (رولي وآخرون. ، 1993). فيما يتعلق بالإجهاد التأكسدي ، أ sod1Δ متحولة (تتأثر في نحاس عصاري خلوي ، ديسموتاز أكسيد الزنك الفائق) تتعرض لـ 100 ٪ O2 تم العثور عليه للاعتقال بشكل دائم في G1 من خلال تثبيط CLN1 و CLN2 النسخ (لي وآخرون. ، 1996) ، ولكن لم يتم التحقيق في تورط نقاط تفتيش الحمض النووي في هذا التثبيط. قد تعمل آلية مماثلة في الخلايا البرية المعالجة بـ H.2ا2 عمل1. ومع ذلك ، فإن المسارات التنظيمية المسؤولة عن G1 وج2- لا يزال يتعين تحديد تأخيرات M في الخلايا البرية المعرضة للإجهاد التأكسدي.

تؤدي معالجة بيروكسيد الهيدروجين إلى تشغيل فسفرة Rad53 تحديدًا خلال المرحلة S.

تحريض الفسفرة Rad53 تحديدًا بعد إضافة H.2ا2 يمكن تفسير خلايا المرحلة S بتأثير تركيزات منخفضة من H2ا2 على نشاط اختزال الريبونوكليوتيد (RNR) من خلال استنفاد عوامل الاختزال. ومع ذلك ، فإن الفسفرة Rad53 في المرحلة S عند التعرض لـ H.2ا2 أكثر كثافة في apn1Δ apn2 الخلايا من الخلايا البرية ، مما يشير بقوة إلى أن آفات الحمض النووي يسببها H2ا2 في هذه المرحلة. علاوة على ذلك ، فإن الملاحظة التي تشير إلى أن الفسفرة Rad53 في الخلايا البرية عولجت بـ H.2ا2 يعتمد جزئيًا على Rad9 و Rad17 ، في حين أن فسفرة Rad53 الناتجة عن تعطيل RNR مستقلة تمامًا عن Rad9 و Rad17 (Pellicioli وآخرون. ، 1999 بياناتنا غير المنشورة) تتفق مع وجود آفات الحمض النووي في المرحلة S. يمكن أن تفسر العديد من الفرضيات الحث المحدد لفسفرة Rad53 في هذه المرحلة. أولاً ، إلى جانب إحداث تلف في الحمض النووي ، فإن H2ا2 يمكن أن يؤثر العلاج أيضًا على نشاط RNR ، ويؤدي إلى نقص في dNTP ويولد إشارة إلى Rad53 يمكن أن تعزز بشكل تآزر إشارة ضعيفة ناتجة عن معالجة آفات الحمض النووي. قد تكون الفرضية الثانية هي أن H2ا2 يتسبب في تلف الحمض النووي أكثر أو مختلفًا خلال المرحلة S بسبب الحساسية الجوهرية لتكرار الحمض النووي ، أو لأن تكرار الحمض النووي يحول الآفات الأولية إلى هياكل DNA (فواصل الحمض النووي ، أو الحمض النووي أحادي الجديلة أو وسائط إعادة التركيب الناتجة عن توقف شوكة النسخ المتماثل) التي يمكن التعرف عليها بواسطة مجسات تلف الحمض النووي (Foiani وآخرون. ، 1998). ثالثًا ، آليات قادرة على استشعار H.2ا2يمكن أن يعمل تلف الحمض النووي الناجم في المرحلة S ولكن ليس في G1 أو جي2. يبدو أن بروتينات تكرار الحمض النووي Pol2 و Dpb11 و Rfc5 وبروتين Tof1 تستشعر كلاً من كتل النسخ وتلف الحمض النووي على وجه التحديد أثناء تخليق الحمض النووي (Araki) وآخرون. ، 1995 نافاس وآخرون. ، 1995 ، 1996 سوجيموتو وآخرون. ، 1996 ، 1997 Foss ، 2001) ويمكن أن يشارك في تشوير H.2ا2يسبب آفات الحمض النووي إلى Rad53.

آفات الحمض النووي المستحثة في G1 وج2 عن طريق تركيزات منخفضة من بيروكسيد الهيدروجين يتم إصلاحها بصمت عن طريق مسار BER في الخلايا البرية وتؤدي فقط إلى فسفرة Rad53 عندما تتم معالجتها بشكل غير كامل من خلال هذا المسار

تم إثبات وجود صلة بين علاج آفات الحمض النووي المستحثة بالأشعة فوق البنفسجية وتفعيل نقاط فحص الحمض النووي مؤخرًا في الخميرة بواسطة Siede وآخرون. (1994) و Neecke وآخرون. (1999) ، الذي أظهر أن التنشيط المستحث بالأشعة فوق البنفسجية لمسار حاجز Rad53 في G1 يعتمد بشكل صارم على بروتين NER Rad14. وبالمثل ، فإن الأرومات اللمفاوية XP-A (تتأثر في تجانس الإنسان لـ RAD14) تتطلب جرعات أعلى بكثير من الإشعاع فوق البنفسجي من الخلايا البرية من أجل إحداث تعبير p53 عندما يتم تثبيط تكاثر الحمض النووي (Nelson and Kastan ، 1994). أظهرت هذه الدراسات أن آفات الحمض النووي الناجمة عن جرعات منخفضة من الأشعة فوق البنفسجية لا تشكل في حد ذاته إشارة كافية لتنشيط نقطة تفتيش الحمض النووي في G1 أو عندما يتم تثبيط تكاثر الحمض النووي ، وأن وجود مجمعات NER فقط أو ظهور وسيطات DNA المشتقة من معالجتها لآفات الحمض النووي الأولية هي القادرة على تنشيط مسارات مراقبة الحمض النووي.

على النقيض من تلف الحمض النووي الناجم عن الأشعة فوق البنفسجية ، فإن آفات الحمض النووي الناتجة عن تركيزات منخفضة من حمض الهيدروكلوريك2ا2 عمل1 أو جي2 قادرون على تنشيط نقاط فحص الحمض النووي فقط عندما تتم معالجتها بشكل غير كامل بواسطة مسار BER. في الخلايا البرية ، آفات الحمض النووي التي يسببها H.2ا2 العلاج في G1 أو جي2 يتم إصلاحها بصمت عن طريق المسارات المعتمدة على Apn1 / Apn2 ، بمعنى أن معالجتها لا تنشط نقاط فحص الحمض النووي. وبالتالي ، فإن إصلاح آفات الحمض النووي لا يرتبط بشكل منهجي بتنشيط نقاط فحص الحمض النووي ولا يبدو أنه يتطلب ذلك لتحقيق الكفاءة المناسبة. وجدنا أن آفات الحمض النووي المستحثة في G1 الخلايا بمقدار 0.8 ملي مولار2ا2 لم يتمكن من تشغيل فسفرة Rad53 عندما وصلت الخلايا لاحقًا إلى المرحلة S (الشكل 4A و C) ، مما يدل على أنه تم إصلاح الآفات في G1 إلى الحد الذي لا يشكل إشارة كافية لنقاط التفتيش في المرحلة S.

يمكن تصنيف الأنواع المختلفة لآفات الحمض النووي وأنظمة الإصلاح الخاصة بها من خلال قدرتها على تنشيط مسارات مراقبة الحمض النووي في غياب تكرار الحمض النووي. يبدو أن المعالجة بواسطة NER ، المسار المعتمد على Rad14 لآفات الحمض النووي المستحثة بالأشعة فوق البنفسجية يمكن اكتشافها بسهولة وإشارة إلى Rad53 ، في حين أن معالجة H2ا2يبدو أن الآفات الناتجة عن المسار المعتمد على BER و Apn1 / Apn2 تمر دون أن يلاحظها أحد من خلال نقاط فحص الحمض النووي. في حالة عدم وجود Apn1 و Apn2 ، يتم تحويل الآفات المؤكسدة الأولية بواسطة glycosylases / AP-lyases إلى مواقع أساسية مع كسر حبلا واحد. ما الذي يدفع إذن Rad53 الفسفرة؟ يمكن استشعار ركائز Apn1 / Apn2 إما مباشرة بواسطة بروتينات نقطة التفتيش أو معالجتها بشكل أكبر بمسارات بديلة إلى وسيطة قادرة على تنشيط نقاط فحص الحمض النووي (الشكل 8). قد تشارك الهليكازات أو نوكليازات في المعالجة البديلة لركائز Apn1 / Apn2. ومن المثير للاهتمام أن Xiao and Chow (1998) أظهروا مؤخرًا ليس فقط تلك الطفرات في جينات NER RAD1, RAD2, RAD4 و RAD10 وفي الجين BER APN1 متآزرة فيما يتعلق بالقتل بواسطة ميثيل ميثان سلفونات (MMS) ، ولكن أيضًا من بين راد apn1Δ المسوخات المتأثرة في كل من مسارات NER و BER ، فإن rad1Δ apn1Δ و rad10Δ apn1Δ تظهر المسوخات المزدوجة أنماطًا ظاهرية فريدة مع معدلات نمو بطيئة وحساسية تآزرية إضافية للرسائل المتعددة الوسائط. تشير هذه الملاحظات إلى أدوار إضافية لمركب Rad1 – Rad10 في مسارات إصلاح الحمض النووي التي قد تكون مرتبطة بـ Apn1 ولكنها تختلف عن نشاط NER. علاوة على ذلك ، تم حذف RAD1 وجد ليكون قاتلًا مع حذف APN1 و APN2 (M.Guillet و S.Boiteux ، الاتصال الشخصي) ، في حين أن الثلاثي apn1Δ apn2Δ rad14Δ متحولة لا تظهر أي عيوب في النمو. تشير هذه الملاحظة أيضًا إلى أن Rad1 ، وهو نوكلياز داخلي يشارك في العديد من مسارات الإصلاح ، يمكن أن يمثل إنزيمًا بديلًا لعلاج ركائز Apn1 / Apn2 ، وربما إشاراتها إلى نقاط فحص الحمض النووي.

إجمالاً ، توضح بياناتنا مفهوم الإصلاح الصامت لتلف الحمض النووي وتوضح الحساسية العالية لخلايا الطور S تجاه H2ا2. نظرًا لأهمية آفات الحمض النووي المؤكسدة في الخلايا الهوائية ، سيكون من المثير للاهتمام تحديد هوية ونشاط أجهزة استشعار تلف الحمض النووي المؤكسد في الخميرة وكذلك في خلايا الثدييات.


النتائج

الحذف السريع والكامل لـ Hus1 في الخلايا المستزرعة الأولية عن طريق إعادة التركيب بوساطة Cre

لفحص الآثار الحادة هوس 1 الخسارة في الخلايا المستزرعة الأولية ، أنشأنا نظامًا وراثيًا للتثبيط المنظم لـ هوس 1 في MEFs. يعتمد هذا النظام على أليل شرطي ، Hus1 flox ، حيث يتم محاطة exons 2 و 3 بمواقع loxP ، تسلسل التعرف على recombinase cre (الشكل 1A). أشارت الدراسات السابقة إلى أن إعادة التركيب cre-mediated at Hus1 flox يحذف exons 2 و 3 ، مما ينتج عنه أليل فارغ ، هوس 1 Δ 2,3 ، التي لديها القدرة على ترميز أول 19 فقط من 281 من الأحماض الأمينية Hus1 (Levitt وآخرون.، 2005). لشرطية هوس 1 تعطيل ، أنشأنا MEFs تحتوي على Hus1 flox وإما هوس 1 Δ 1 ، وهو أليل فارغ تأسيسي حيث تم حذف exon 1 وكودون البداية (Weiss وآخرون.، 2000) ، أو من النوع البري هوس 1 كعنصر تحكم ، ثم إجراء عدوى مع Ad-cre. معا Hus1 flox / + و Hus1 flox /Δ 1 MEFs ، تم توقع إعادة التركيب بوساطة cre-mediation لتحويل الأليل الشرطي إلى أليل فارغ هوس 1 Δ2,3 . الإعلانات المصابة هوس 1 فلوكسستستمر الخلايا / + في التعبير هوس 1 من أليل النوع البري المتبقي ، في حين عدوى Ad-cre هوس 1 flox /Δ1 لن تنتج الخلايا وظيفية هوس 1 النصوص (الشكل 1 أ).

الشكل 1. تعطيل مشروط هوس 1 في MEFs الأولية باستخدام Ad-cre. (أ) رسم تخطيطي لنظام التعطيل المشروط لـ هوس 1. المختلف هوس 1 يشار إلى الأليلات المستخدمة ، مع إظهار أول عدة إكسونات. هوس 1 فلوكس هو شرط هوس 1 الأليل الذي يحيط به exons 2 و 3 مواقع loxP (مثلثات سوداء). بعد عدوى Ad-cre ، exons 2 و 3 من Hus1 flox يتم حذف الأليل ، مما ينتج عنه الأليل الفارغ هوس 1 Δ2,3 . لا يعمل هوس 1 نسخة تفتقر إلى exons 2 و 3 يتم إنتاجها من هوس 1 Δ 2,3 ويمثلها خط منقط. هوس 1 Δ 1 هو أليل فارغ تأسيسي يفتقر إلى exon 1 وتسلسلات المنبع الإضافية. الإعلانات المصابة هوس 1 فلوكس/ + تواصل MEFs التعبير عن النوع البري هوس 1 من عند هوس 1 + ، في حين أن الإعلانات المصابة هوس 1 flox /Δ1 تفشل MEFs في إنتاج أي وظيفية هوس 1 النصوص. (ب) تحليل اللطخة الجنوبية هوس 1 الحذف بعد عدوى Ad-cre. تم تحضير الحمض النووي الجيني من Hus1 flox / + و هوس 1 flox /Δ1 MEFs عند 1 أو 2 أو 3 أو 4 أيام بعد الإصابة مع Ad-cre أو في 2 d بعد العدوى الوهمية (U ، غير مصاب) ثم تعرض لتحليل اللطخة الجنوبية. لم يتم تمرير الخلايا المستخدمة في هذه التجربة بعد عدوى إعلانية أو وهمية مواقف Hus1 flox , هوس 1 + و و هوس 1 Δ 2,3 يشار إلى العصابات. ال هوس 1 Δ 1 لم يتم الكشف عن الأليل في هذا الاختبار. (ج) تحليل اللطخة الشمالية لمرنا المحضر من الخلايا المحضرة أو المصابة بالعدوى الوهمية Hus1 flox / + و Hus1 flox / Δ1 MEFs. تم إنتاج مواقف النصوص من Hus1 flox , هوس 1 + و و هوس 1 Δ 2,3 يشار إلى.

في البداية ، الحد الأدنى من جرعة Ad-cre المطلوبة للحذف الكامل لـ Hus1 flox تم تحديد الأليل لتقليل السمية الخلوية التي يسببها cre (Loonstra وآخرون.، 2001 Silver and Livingston، 2001). Hus1 flox / + أصيبت الخلايا بجرعات مختلفة من Ad-cre ، وتم عزل الحمض النووي الجيني بدقة 2 نقطة في البوصة وإخضاعها لتحليل اللطخة الجنوبية. بمجرد تحديد الحد الأدنى من جرعة Ad-cre الفعالة (البيانات غير معروضة) ، حركية هوس 1 تم فحص التعطيل. بحلول يوم واحد بعد الإصابة بالحد الأدنى من جرعة Ad-cre ، فإن Hus1 flox تم تحويل الأليل بالكامل إلى هوس 1 Δ 2,3 معا Hus1 flox / + و Hus1 flox / Δ1 MEFs (الشكل 1 ب). تم إجراء تحليل اللطخة الشمالية أيضًا للتقييم هوس 1 التعبير في الأوقات المقابلة بعد عدوى Ad-cre. كما هو مبين في الشكل 1C ، مصابة وهمية Hus1 flox / + و هوس 1 flox /Δ1 عبرت كل من الخلايا عن النوع البري هوس 1 النصوص ، مع مستوى التعبير أعلى في Hus1 flox / + خلايا من Hus1 flox / Δ1 الخلايا كما هو متوقع. بسرعة 1 نقطة في البوصة ، من النوع البري هوس 1 لم تعد النصوص قابلة للاكتشاف في Ad-cre –haved Hus1 flox / Δ1 الخلايا وتم استبدالها بـ mRNA منخفض الوزن الجزيئي يتوافق مع غير وظيفي هوس 1 Δ 2,3 نسخة طبق الأصل. الإعلانات المصابة Hus1 flox تعبر / + الخلايا عن كلا النوعين البريين هوس 1 و هوس 1 Δ 2,3 النصوص كما كان متوقعًا. باختصار ، تثبت هذه النتائج أن عدوى Ad-cre للضربة القاضية المشروطة MEFs تسمح بالتعطيل السريع والفعال لـ هوس 1.

يؤدي فقدان Hus1 إلى انخفاض تكاثر الخلايا وزيادة موت الخلايا المبرمج

مشتق من الخلايا الليفية هوس 1- فشل الأجنة الناقصة في التكاثر في الثقافة (Weiss وآخرون.، 2000). ومع ذلك ، فإن هذه التجارب معقدة بسبب حقيقة أن هوس 1- يجب الحصول على الخلايا الخالية من الأجنة غير الطبيعية من الناحية الشكلية في مرحلة نمو أبكر بكثير مما هو معتاد في ثقافة MEF. الشرط هوس 1 أتاح نظام خروج المغلوب الفرصة لإلغاء تنشيطه بسرعة هوس 1 في عدد كبير من السكان من MEFs العادية واختبار التأثير الفوري هوس 1 نقص في بيئة خاضعة للرقابة. لفحص تأثير هوس 1 الخسارة في تكاثر الخلايا ، قمنا أولاً بتحديد قيم PDLs للمصابين الوهميين والمصابين بالعدوى Hus1 flox / + و Hus1 flox / Δ1 MEFs تمت تربيتها وفقًا لجدول مرور 3T3 تقليدي. كما هو مبين في الشكل 2 أ ، تضاعفت MEFs لجميع الأنماط الجينية في البداية بشكل مماثل. ومع ذلك ، بعد 4 نقطة في البوصة Ad-cre - المصابة Hus1 flox / Δ1 تراكمت MEFs أقل بكثير من PDLs من التحكم في عدوى Ad-cre Hus1 flox / + MEFs أو مصابة وهمي Hus1 flox / Δ1 MEFs. تحدد هذه النتائج دورًا مهمًا لـ هوس 1 في الخلية تتضاعف في ظل ظروف النمو الطبيعي.

الشكل 2. تعطيل مشروط هوس 1 يؤدي إلى ضعف تكاثر الخلايا وزيادة موت الخلايا المبرمج. (أ) تحليل تكاثر الخلايا. Hus1 flox / + و هوس 1 flox /Δ1 تم إصابة MEFs في الممر الأول بالعدوى Ad-cre أو Mock ثم تم زراعتها وفقًا لجدول 3T3 الثقافة كما هو موضح في المواد والأساليب. تُظهر المؤامرة عدد رموز PDL المتراكمة. (ب) تمثيل تخطيطي لمؤامرة نقطة FACS لتوزيع دورة الخلية. كثافة تلطيخ PI (x-axis) مقابل ذلك الخاص بـ Anti-BrdU-FITC (ذ-محور). ينقسم مجتمع المرحلة S إلى S1 (BrdU إيجابي) و S2 (BrdU سلبي). (ج) آثار هوس 1 الخسارة في توزيع دورة الخلية. تم تصنيف MEFs للأنماط الجينية المشار إليها باستخدام BrdU في الأوقات المحددة بعد الإصابة أو العدوى الوهمية ، وملطخة بمضاد BrdU و PI ، وتم تحليلها بواسطة قياس التدفق الخلوي. تم تمرير الخلايا قبل 1 د قبل وضع العلامات BrdU. يشار إلى النسبة المئوية للخلايا في كل مرحلة من مراحل دورة الخلية. (D و E) زيادة موت الخلايا المبرمج بعد التعطيل المشروط لـ هوس 1. تم تلوين MEFs للأنماط الجينية المشار إليها باستخدام Annexin V-FITC و PI في الأوقات المحددة بعد الإصابة أو العدوى الوهمية وتم تحليلها عن طريق قياس التدفق الخلوي. (D) يظهر الرسم النسبة المئوية للخلايا المبرمج (Annexin V إيجابي ، PI سلبي). القيم هي متوسط ​​ثلاث تجارب مستقلة ، مع أشرطة الخطأ التي تمثل SD. (هـ) مخططات نقطية تمثيلية لـ FACS تظهر موت الخلايا المبرمج في خلايا الأنماط الجينية المشار إليها في 7 د بعد العدوى أو العدوى الوهمية. كثافة تلطيخ PI (x-axis) مقابل ذلك الخاص بـ Annexin V-FITC (ذ-محور). يشار إلى النسبة المئوية للخلايا المصنفة على أنها موت الخلايا المبرمج (الربع العلوي الأيسر الملحق V موجب ، PI سلبي) أو نخرية (أعلى الربع الأيمن ملحق V إيجابي ، PI إيجابي).

الخلية المختزلة تتضاعف هوس 1 يمكن أن تكون خلايا الضربة القاضية الشرطية ناتجة عن توقف دورة الخلية أو موت الخلايا المبرمج أو كليهما. للتمييز بين هذه الاحتمالات ، قمنا أولاً بمراقبة تطور Hus1 flox / + و هوس 1 flox /Δ1 MEFs من خلال دورة الخلية بعد عدوى Ad-cre. تم حصاد الثقافات غير المتزامنة بعد وضع العلامات باستخدام BrdU عند 2 أو 4 أو 6 نقطة في البوصة. كشف تحليل توزيع دورة الخلية بواسطة نظام مراقبة الأصول الميدانية ثنائي المتغير عدم وجود فروق ذات دلالة إحصائية بين الخلايا المختلفة هوس 1 الأنماط الجينية بدقة 2 نقطة في البوصة (الشكل 2 و B و C). ومع ذلك ، في كل من 4 و 6 نقطة في البوصة ، لوحظت مجموعة صغيرة من الخلايا التي تمتلك محتوى من الحمض النووي في المرحلة S ولكنها كانت سلبية BrdU (المعينة S2) على وجه التحديد على وجه التحديد في Ad-cre- المصابة هوس 1 flox /Δ1 الثقافات (5.38٪ عند 4 نقطة في البوصة و 4.61٪ عند 6 نقطة في البوصة). كانت هذه الخلايا غير الطبيعية في الطور S نادرة في السيطرة على عدوى الخلايا الإعلانية هوس 1 فلوكس/ + الثقافات (1.40٪ في 4 نقطة في البوصة و 1.50٪ في 6 نقطة في البوصة) وكذلك الثقافات غير المصابة. لم يتأثر توزيع الخلايا في المراحل الأخرى من دورة الخلية إلى حد كبير هوس 1 خسارة. تراكم طفيف للعدوى هوس 1 flox /Δ1 MEFs في G2لوحظ / M ، ولكن لوحظت نتائج مماثلة في Ad-cre –inaled Hus1 flox / + MEFs.

مساهمة موت الخلايا المبرمج في تقليل مضاعفة الشرط هوس 1 تم فحص الخلايا القاضية أيضًا.تم قياس موت الخلايا المبرمج عن طريق تحليل التدفق الخلوي للخلايا الملطخة بـ Annexin V ، وهو بروتين مرتبط بالفوسفوليبيد يمكن استخدامه لتحديد الخلايا التي تم فيها نقل الفوسفاتيديل سيرين من الداخل إلى المنشور الخارجي لغشاء البلازما ، وهو علامة على موت الخلايا المبرمج (Vermes وآخرون.، 1995). تم تلوين الخلايا أيضًا بـ PI كمقياس لسلامة الغشاء ، لتمييز الخلايا السليمة في المراحل الأولية من موت الخلايا المبرمج من الخلايا التي تمر بالنخر أو غيرها من أشكال موت الخلايا. النسبة المئوية للخلايا في المراحل المبكرة من موت الخلايا المبرمج (Annexin V + PI -) مشروطة هوس 1 يظهر الشكل 2D الثقافات بالضربة القاضية والتحكم. أبعد من 4 نقطة في البوصة ، Ad-cre - مصابة هوس 1 flox /Δ1 تحتوي الثقافات باستمرار على نسبة أكبر من الخلايا المبرمجة من الخلايا المصابة بالعدوى Hus1 flox / + والمصابين الوهميين هوس 1 flox /Δ1 الثقافات ، على الرغم من أن هذه الاختلافات لم تكن ذات دلالة إحصائية. على سبيل المثال ، بدقة 7 نقطة في البوصة ، 12.3 ± 2.5٪ من الإعلانات المصابة هوس 1 flox /Δ1 كانت الخلايا موت الخلايا المبرمج ، مقابل 9.0 ± 2.1٪ من الخلايا المصابة Hus1 flox / + خلايا أو 9.5 ± 1.1٪ مصابة وهمية هوس 1 flox /Δ1 الخلايا. مخططات تمثيلية تظهر تحليل FACS للاستماتة في الشرط هوس 1 يتم عرض الثقافات بالضربة القاضية في الشكل 2E. معا ، النتائج تشير إلى ذلك هوس 1 يؤدي التعطيل إلى تقليل مضاعفة الخلايا من خلال التعديلات الدقيقة في دورة الخلية وزيادة موت الخلايا المبرمج.

تشوهات الكروموسومات العفوية بعد التثبيط المشروط لـ Hus1

يعمل Hus1 في مسار ضروري للحفاظ على السلامة الجينية. لتحديد مدى الضرر الجينومي بشكل شرطي هوس 1 تم تحديد تواتر التشوهات الجسيمة للكروموسومات في انتشار الطور الطوري المحضر من الخلايا المصابة بالعدوى. Hus1 flox / + و هوس 1 flox /Δ1 MEFs. الإعلانات المصابة هوس 1 flox /Δ1 أظهرت الخلايا زيادة كبيرة في تشوهات الكروموسومات التي تم اكتشافها لأول مرة عند 5 نقطة في البوصة (الجدول 1). بحلول هذا الوقت ، 55٪ من الشرطية هوس 1 كان للخلايا المنقطعة شذوذ واحد على الأقل ، و 45٪ بها أكثر من تشوهين ، بما في ذلك العديد من الخلايا ذات الضرر الجينومي الواسع الذي لا يمكن قياسه كمياً. على النقيض من ذلك ، فإن 11.8٪ فقط من السيطرة على الإعلانات مصابة Hus1 flox / + MEFs احتوت على شذوذ الكروموسومات عند 5 نقطة في البوصة ، ولم يكن لأي منها أكثر من تشوهين. كانت الكسور والفجوات في الكروموسومات التي تؤثر على كروماتيد واحد هي التشوهات الأكثر شيوعًا في الشرط هوس 1 خلايا خروج المغلوب (الشكل 3 أ والجدول 1). كما لوحظت التبادلات الكروماتيدية بتردد منخفض.

الجدول 1. تعطيل مشروط هوس 1 يؤدي إلى زيادة تشوهات الكروموسومات أ

تم تحضير كروموسومات الطور الطوري من خلايا الطرز الجينية المشار إليها ، وتم تحديد حدوث تشوهات الكروموسومات.

(ب) بعد أيام من الإصابة بعدوى.

ج يشير الضرر الواسع إلى الميتافاز التي تحتوي على عدد كبير جدًا من تشوهات الكروموسومات التي لا يمكن عدها.

الشكل 3. شرطي هوس 1 يؤدي التعطيل إلى تشوهات الكروموسومات وفسفرة H2AX في MEFs الأولية. (أ) زيادة شذوذ الكروموسومات الإجمالي في هوس 1 خلايا خروج المغلوب الشرطية. تم تحضير ينتشر الطور من Hus1 flox / + و هوس 1 flox /Δ1 MEFs في 1 و 3 و 5 أيام بعد عدوى Ad-cre أو في 2 d بعد عدوى وهمية (U ، غير مصاب). تم تمرير الخلايا التي تم تحليلها عند 3 أو 5 نقطة في البوصة 2 د قبل إعداد انتشار الطور الطوري. يتم عرض الصور التمثيلية ، مع رؤوس سهام تشير إلى تشوهات صبغية. (B و C) تراكم γ-H2AX في هوس 1 خلايا خروج المغلوب الشرطية. (ب) تم تحديد النسبة المئوية للخلايا الإيجابية γ-H2AX عن طريق مقايسة التألق المناعي غير المباشر. القيم هي متوسط ​​عدد الخلايا مع العدد المشار إليه من بؤر γ-H2AX من ثلاثة حقول مجهر 40 × مستقلة ، مع أشرطة خطأ تمثل SD. (C) تم تحديد توزيع دورة الخلية للخلايا الإيجابية H-H2AX عن طريق تحليل نظام مراقبة الأصول الميدانية. تم تلوين MEFs للأنماط الجينية المشار إليها بجسم مضاد لـ γ-H2AX و PI عند 4 أو 7 أيام بعد عدوى Ad-cre أو عدوى وهمية وتم تحليلها بواسطة قياس التدفق الخلوي. يشار إلى النسبة المئوية للخلايا الإيجابية γ-H2AX في المرحلة S.

لمزيد من توصيف الضرر الجينومي التلقائي الذي يحدث بعد التنظيم هوس 1 التعطيل ، أجرينا فحوصات التألق المناعي للكشف عن γ-H2AX ، الشكل الفسفوري من هيستون H2AX الذي يتراكم في DSBs. على الرغم من أن فسفرة H2AX تتطلب إشارة نقطة تفتيش ، إلا أن الدراسات السابقة أشارت إلى أن Hus1 يمكن الاستغناء عنه لتراكم γ-H2AX بعد إجهاد النسخ المتماثل (Ward and Chen ، 2001). كما هو مبين في الشكل 3 ب ، كانت هناك زيادة طفيفة في تلطيخ γ-H2AX في هوس 1 flox /Δ1 الخلايا في 4 أيام بعد عدوى Ad-cre ، وبنسبة 7 نقطة في البوصة 16.9 ± 3.9٪ من الإصابة بفيروس Ad-cre هوس 1 flox /Δ1 احتوت الخلايا على & gt10 γ-H2AX بؤر إيجابية ، مقارنةً بـ 3.1 ± 3.4٪ فقط من الخلايا المصابة بالعدوى Hus1 flox / + MEFs. مصابة وهمية Hus1 flox / + و هوس 1 flox /Δ1 عرضت الخلايا مستوى خلفية منخفضًا من تلطيخ γ-H2AX مشابهًا لذلك الذي لوحظ في Ad-Cre المصابة Hus1 flox / + خلايا (البيانات غير معروضة). هكذا، هوس 1 ينتج عن الخسارة على وجه التحديد زيادة فسفرة H2AX وظهور تشوهات الكروموسومات. قمنا بعد ذلك بالتحقيق فيما إذا كانت آفات الحمض النووي هذه قد نشأت في مرحلة معينة من دورة الخلية. تم تحقيق ذلك عن طريق تحليل نظام مراقبة الأصول الميدانية ثنائي المتغير للمصابين الوهميين والمصابين بفيروس الإعلان Hus1 flox / + و هوس 1 flox /Δ1 الخلايا بعد تلطيخها بجسم مضاد لـ γ-H2AX و PI. أكدت النتائج زيادة فسفرة H2AX في المصابين بالعدوى هوس 1 flox /Δ1 وأشار كذلك إلى أن تراكم γ-H2AX بعد هوس 1 اقتصر الخسارة إلى حد كبير على الخلايا ذات محتوى الحمض النووي S-phase (الشكل 3C). الأهم من ذلك ، أن هذا الاكتشاف لم يكن بسبب عدم قدرة هذه الطريقة على اكتشاف γ-H2AX في مراحل أخرى من دورة الخلية ، لأنه لوحظ تلطيخ إيجابي في G1و S و G2/ M السكان بعد معالجة الخلايا بالسموم الجينية الخارجية (البيانات غير معروضة Marti وآخرون.، 2006). باختصار ، تشير هذه النتائج إلى ذلك الشرطي هوس 1 يؤدي التعطيل إلى زيادة عدم الاستقرار الجيني وتراكم DSB في المرحلة S من دورة الخلية.

زيادة تعبير الموقع الهش الشائع بعد تعطيل Hus1

آفات الحمض النووي العفوية شرطية هوس 1 يمكن أن تنشأ الخلايا القاضية بشكل عشوائي في جميع أنحاء الجينوم أو في مناطق جينومية معينة. لأن Hus1 مطلوب لوظيفة نقطة تفتيش S-phase وأيضًا ضروري للاستجابات الخلوية لضغوط التكرار الخارجية (Weiss وآخرون.، 2000 ، 2003) ، قمنا باختبار ما إذا كان الكروموسوم العفوي ينكسر أم لا هوس 1- ظهرت الخلايا الناقصة بشكل تفضيلي في المساحات الصديقة لألطفال ، المناطق الجينومية المعرضة للكسر في ظل ظروف إجهاد النسخ المتماثل (جلوفر وآخرون.، 2005). لهذا الغرض ، تم إجراء فحوصات FISH لتحديد عدد المرات التي يتم فيها تحديد فواصل الكروموسومات المترجمة إلى المساحات الصديقة لألطفال في الحالة الشرطية. هوس 1 بالضربة القاضية الخلايا. تم اكتشاف CFSs باستخدام مجسات تم تحضيرها من الكروموسومات الاصطناعية البكتيرية التي تحتوي على تسلسل جينومي للفأر من المواقع الهشة Fra8E1 و Fra6C1. تمشيا مع النتائج الواردة في الشكل 3A والجدول 1 ، Ad-cre - المصابة هوس 1 flox /Δ1 عرضت الخلايا في المتوسط ​​1.60-2.30 فاصلًا لكل خلية ، في حين أن الخلايا المصابة بالعدوى الإعلانية Hus1 flox / + عرضت الخلايا فقط 0.18-0.21 كسر كروموسومي لكل خلية في المتوسط ​​(الجدول 2). والجدير بالذكر ، لوحظ زيادة كبيرة في وتيرة الكسر العفوي CFS في الشرطية هوس 1 بالضربة القاضية الخلايا. في CFS Fra8E1 ، تم تحديد تسع فواصل من بين 233 موقعًا تم تحليلها في Ad-cre-nexted هوس 1 flox /Δ1 مقارنةً بعدم وجود فواصل في 264 موقعًا تم تحليلها في مجموعة التحكم المصابة Hus1 flox / + خلايا. ما يقرب من 10٪ (9 من 91) من الفواصل والفجوات العفوية في هوس 1- الخلايا الناقصة المترجمة إلى هذا الموقع الهش. وبالمثل ، تم تحديد خمس فواصل بين 151 موقع CFS Fra6C1 تم تحليلها في Ad-cre المصابة هوس 1 flox /Δ1 الخلايا ، وهو ما يمثل 5.7 ٪ من الفواصل الملحوظة (5 من 87) ، ولكن لم يتم اكتشاف أي منها في عدوى Ad-cre. Hus1 flox / + خلايا. تظهر صور FISH التمثيلية في الشكل 4. تشير هذه النتائج إلى أن الفواصل العفوية التي تنشأ عليها هوس 1 تحدث الخسارة بشكل تفضيلي في المساحات الصديقة لألطفال ، مما يؤدي إلى إنشاء دور جديد لها هوس 1 في الحفاظ على استقرار CFS.

الجدول 2. التعطيل المشروط هوس 1 يؤدي إلى زيادة التعبير الموقع الهش الشائع أ

تم استخدام FISH للكشف عن مواقع CFS Fra8E1 أو Fra6C1 كما هو موضح في المواد والأساليب.

(ب) تحتوي الخلايا الفردية أحيانًا على عدد أقل أو أكثر من إشارات FISH الأربعة المتوقعة بسبب فقدان الكروموسوم أو تعدد الصبغيات ، وبالتالي ، فإن العدد الإجمالي لمواقع CFS التي تم تحليلها لم يكن بالضبط 4 أضعاف عدد الخلايا التي تم تحليلها.

الشكل 4. زيادة التعبير عن المواقع الهشة الشائعة بعد هوس 1 تعطيل. تنتشر الصور التمثيلية للتعبير CFS في الطور الطوري المحضر من Ad-cre –ديد هوس 1 flox /Δ1 MEFs. تم تمرير الخلايا عند 2 نقطة في البوصة ، وتم حصادها لإعداد انتشار الطور عند 4 ديسيبل متوحد الخواص ، ثم ملطخة بمجسات خاصة بـ CFS Fra8E1 (A) أو Fra6C1 (B) (أخضر) ومقاومتها بـ DAPI (أزرق). تظهر الصور المدمجة لتلطيخ CFS و DAPI (أعلى) أو الصور المقابلة مع تلطيخ DAPI وحده (أسفل). تشير الأسهم إلى متلازمة التعب المزمن في مواقع الكروموسومات السليمة ، وتشير رؤوس الأسهم إلى تكوّن CFS والفواصل أو الفجوات الصبغية.

يتراكم p53 بعد تعطيل Hus1 الشرطي ، لكن الانتشار الضعيف وزيادة الأنماط الظاهرية لموت الخلايا المبرمج يستمران في غيابه

ملاحظة زيادة التشوهات الصبغية العفوية بعد الخضوع للتنظيم هوس 1 أثار الحذف احتمال أن يكون انخفاض الانتشار المصاحب وزيادة موت الخلايا المبرمج ناتجًا عن استجابة تلف الحمض النووي المستقل عن Hus1. لقد أبلغنا سابقًا أن p53 يتم تنشيطه في هوس 1أجنة خالية ، مما يؤدي إلى زيادة التعبير عن الجينات المستهدفة p53 (Weiss وآخرون.، 2002) ، وعلاوة على ذلك ص 21 أو ص 53 يسمح التعطيل بالثقافة التسلسلية لـ هوس 1-نقص MEFs (Weiss وآخرون.، 2000 بياناتنا غير المنشورة). لذلك افترضنا ذلك الشرطي هوس 1 يؤدي التعطيل إلى تنشيط p53 والاستجابات اللاحقة لنقاط التفتيش. نظرًا لأن تنشيط p53 مرتبط بتثبيت وتراكم البروتين p53 (Harris and Levine ، 2005) ، قمنا أولاً بقياس مستويات p53 على مستوى الخلية المفردة عن طريق مقايسة التألق المناعي. عادةً ما يكون p53 عند مستويات منخفضة جدًا في الخلايا البرية وفقًا لذلك ، & lt3٪ من خلايا Ad-cre مصابة Hus1 flox تم العثور على خلايا / + لتكون p53 موجبة عند 4 أو 7 أو 10 نقطة في البوصة. على النقيض من ذلك ، 12.7 ± 5.8 و 14.3 ± 1.4٪ من هوس 1 flox /Δ1 كانت الخلايا p53 إيجابية في 7 و 10 د بعدوى Ad-cre ، على التوالي (الشكل 5A). نستنتج أن الشرط هوس 1 يؤدي التعطيل إلى تراكم p53.

الشكل 5. p53 يتراكم بعد الشرطي هوس 1 تعطيل ، لكن حذفه فشل في إنقاذ الخلية المعطلة بشكل كامل أو مضاعفة موت الخلايا المبرمج في هوس 1 خلايا خروج المغلوب الشرطية. (أ) مستويات p53 في Hus1 flox / + و هوس 1 flox /Δ1 MEFs بعد عدوى Ad-cre. تم تحديد النسبة المئوية للخلايا إيجابية p53 في الأوقات المحددة بعد الإصابة عن طريق مقايسة التألق المناعي. القيم هي متوسط ​​عدد الخلايا الإيجابية لـ p53 من ثلاثة حقول مجهر 40 × مستقلة ، مع أشرطة خطأ تمثل SD. (ب) تحليل مضاعفة الخلية التالية هوس 1 التعطيل في أ ص 53- خلفية ناقصة. تم إصابة MEFs من الطرز الجينية المشار إليها في المقطع الثاني بالعدوى Ad-cre أو الوهمية ثم تم تربيتها وفقًا لجدول مرور 3T3. يتم رسم مخططات PDL التراكمية. (ج) عيوب دورة الخلية المحسنة التالية هوس 1 التعطيل في أ ص 53- خلفية ناقصة. تم تسمية MEFs المصابة Ad-cre للأنماط الجينية المشار إليها بـ BrdU وتحليلها بواسطة قياس التدفق الخلوي كما هو موضح في وسيلة الإيضاح في الشكل 2. يشار إلى النسبة المئوية للخلايا في كل مرحلة من مراحل دورة الخلية. (د) موت الخلايا المبرمج بعد الشرطي هوس 1 التعطيل في أ ص 53-null الخلفية. تم تلوين MEFs للأنماط الجينية المشار إليها باستخدام Annexin V-FITC و PI وتم تحليلها بواسطة قياس التدفق الخلوي. تظهر المخططات النسبة المئوية للخلايا التي تخضع لموت الخلايا المبرمج (Annexin V إيجابي ، PI سلبي). القيم هي متوسط ​​ثلاث تجارب مستقلة ، مع أشرطة الخطأ التي تمثل SD. (هـ) تراكم γ-H2AX في Hus1 flox /+ ص 53 - / - و هوس 1 flox /Δ1 ص 53 - / - MEFs بعد عدوى Ad-cre. تم تحديد النسبة المئوية للخلايا الإيجابية γ-H2AX عن طريق مقايسة التألق المناعي كما هو موضح في وسيلة الإيضاح في الشكل 3.

قمنا بعد ذلك باختبار دور p53 بشكل مباشر في عيوب تكاثر الخلايا وزيادة موت الخلايا المبرمج الذي يحدث بعد الشرطي هوس 1 قصا. لهذا الغرض ، نحن مثقف هوس 1 خلايا الضربة القاضية الشرطية في أ ص 53- خلفية ناقصة. هوس 1 flox /Δ1 ص 53 +/+ , هوس 1 flox /Δ1 ص 53 −/− , Hus1 flox /+ ص 53 + / + و Hus1 flox /+ ص 53 - / - أصيبت MEFs ببرنامج Ad-cre وتم تربيتها وفقًا لجدول مرور 3T3. على غرار نتائج الشكل 2 ب ، Ad-cre - المصابة هوس 1 flox /Δ1 ص 53 تضاعفت الخلايا + / + في البداية بالإضافة إلى عدوى Ad-cre Hus1 flox /+ ص 53 + / + MEFs ، لكنها أظهرت تضاعفًا منخفضًا بعد 4 نقطة في البوصة (الشكل 5 ب). تأثير هوس 1 كان التعطيل مشابهًا في ص 53- الخلفية الناقصة ، على الرغم من أنه بشكل عام ص 53تتضاعف الخلايا الخالية من الخلايا بسرعة أكبر من خلاياها ص 53 نظرائهم من النوع البري. على وجه التحديد ، الإعلانات المصابة هوس 1 flox /Δ1 ص 53 - / - تضاعف الخلايا وكذلك الخلايا المصابة Hus1 flox /+ ص 53 - / - MEFs حتى 4 نقطة في البوصة ولكن بعد ذلك أظهرت انخفاضًا في المضاعفة التي تمت ملاحظتها في ص 53 + / + خلايا. هكذا، ص 53 لم ينقذ الحذف عيب مضاعفة الخلية في الشرط هوس 1 بالضربة القاضية الخلايا. لا يمكن أن تمتد هذه التجارب إلى ما بعد 7 نقطة في البوصة ، لأن الثقافات أصبحت متضخمة هوس 1 flox /Δ1 ص 53 - / - الخلايا التي فشلت في الخضوع هوس 1 حذف. من خلال اللطخة الجنوبية ، كانت هذه الخلايا التي ظل فيها الأليل الشرطي غير متحد نادرة جدًا بعد عدوى Ad-cre مباشرة ، لكنها شكلت غالبية الثقافة بمقدار 7 نقطة في البوصة (البيانات غير معروضة).

لتحديد ما إذا كان p53 توسط الاستجابات الأخرى لعدم الاستقرار الجيني بعد ذلك هوس 1 الخسارة ، قمنا بعد ذلك بفحص آثار ص 53 نقص في توزيع دورة الخلية والاستماتة في هوس 1 خلايا خروج المغلوب الشرطية. تمشيا مع النتائج الواردة في الشكل 2 ب ، لم تكن هناك اختلافات واضحة في ملامح دورة الخلية هوس 1 flox /Δ1 ص 53 + / + و Hus1 flox /+ ص 53 + / + الخلايا بدقة 2 نقطة في البوصة (الشكل 5 ج). ومع ذلك ، كما لوحظ سابقًا ، كانت مجموعة صغيرة ولكنها مهمة من خلايا BrdU سلبية الطور S (S2) (3.08 ٪) موجودة في Ad-cre-المصابة هوس 1 flox /Δ1 ص 53 + / + الثقافات بنسبة 5 نقطة في البوصة. بدلاً من قمع تراكم خلايا S2 ، ص 53 أدى النقص في الواقع إلى زيادة تواترها بشكل ملحوظ ، حيث بلغت نسبة الإصابة 9.11٪ من المصابين هوس 1 flox /Δ1 ص 53 - / - كانت الخلايا موجودة في الجزء S2 عند 5 نقطة في البوصة. ص 53 فشل الحذف أيضًا في منع الزيادة النسبية في موت الخلايا المبرمج المرتبط بالشرطية هوس 1 التعطيل ، على الرغم من أنه تسبب في انخفاض إجمالي في موت الخلايا المبرمج ، بغض النظر عن هوس 1 الحالة (الشكل 5 د). تمشيا مع نتائج الشكل 2D ل ص 53- التعبير عن MEFs ، 14.1 ± 2.2٪ من المصابين بفيروس Ad-cre هوس 1 flox /Δ1 ص 53 كانت الخلايا + / + موت الخلايا المبرمج عند 7 نقطة في البوصة ، بينما كانت 8.8 ± 2.6٪ من الخلايا المصابة Hus1 flox /+ ص 53 + / + الخلايا كانت موت الخلايا المبرمج في نفس النقطة الزمنية. وبالمثل ، فإن 10.8 ± 1.2٪ من المصابين بالعدوى هوس 1 flox /Δ1 ص 53 - / - الخلايا كانت موت الخلايا المبرمج عند 7 نقطة في البوصة ، مقارنة مع 3.7 ± 0.8 ٪ فقط من المصابين بمرض Ad-cre Hus1 flox /+ ص 53 - / - الخلايا. باختصار، ص 53 فشل الخسارة في قمع موت الخلايا المبرمج المتزايد بشكل مشروط هوس 1 خروج المغلوب للخلايا وتفاقم عيوب دورة الخلية المرتبطة هوس 1 تعطيل.

أخيرًا ، اختبرنا ما إذا كان ص 53 سيؤثر النقص على مدى تراكم DSB في الشرط هوس 1 بالضربة القاضية الخلايا. كان هناك تواتر منخفض للخلايا الإيجابية γ-H2AX في خلايا Ad-cre المصابة Hus1 flox /+ ص 53 - / - الثقافات. احتوت 1.2 ± 0.5٪ من هذه الخلايا على أكثر من 10 بؤر H-H2AX بدقة 7 نقطة في البوصة (الشكل 5E) ، مقارنةً بنتائج Ad-cre - المصابة Hus1 flox /+ ص 53 + / + الثقافات (الشكل 3 ب). أظهرت الثقافات المصابة بالعدوى الوهمية من جميع الأنماط الجينية مستوى منخفض مماثل من تلطيخ γ-H2AX (البيانات غير معروضة). ومن المثير للاهتمام ، الجمع ص 53 نقص مشروط هوس 1 لم يقلل التعطيل ولكن بدلاً من ذلك زاد تلطيخ γ-H2AX بشكل طفيف بالنسبة لتأثير هوس 1 الخسارة وحدها. لقد قررنا أن 21.1 ± 1.5٪ من المصابين بفيروس Ad-cre هوس 1 flox /Δ1 ص 53 - / - احتواء MEFs وبؤر gt10 γ-H2AX بدقة 7 نقطة في البوصة (الشكل 5E) مقارنة بـ 16.9 ± 3.9٪ من المصابين بفيروس Ad-cre هوس 1 flox /Δ1 ص 53 + / + MEFs (الشكل 3 ب). معًا ، تشير النتائج إلى ذلك ص 53 الخسارة لا تقلل من تراكم أضرار الجينوم بشكل شرطي هوس 1 خروج المغلوب للخلايا أو قمع عيوب تكاثر الخلايا وموت الخلايا المبرمج الناتج.


الكروماتين وتنظيم أصول النسخ

يجب أن يتم اختيار وتفعيل أصول تكرار الحمض النووي في سياق بيئة الكروماتين المحلية. وجدت الدراسات المبكرة التي فحصت أنماط دمج الثيميدين ذات العلامات الإشعاعية أن مجالات كروموسومية معينة قد تكررت في أوقات منفصلة في المرحلة S (Goldman et al. 1984). تم نسخ كروماتين حقيقي نشط نسبيًا في وقت مبكر من المرحلة S ، في حين تم نسخ الكروماتين المتغاير المكثف والفقير في الجينات في نهاية المرحلة S. اقترحت هذه التجارب وما شابهها (Stambrook and Flickinger 1970) أن بيئة الكروماتين المحلية لم تؤثر فقط على برنامج النسخ ولكن أيضًا على برنامج تكرار الحمض النووي.

في S. cerevisiae، تم تحديد أصول تكرار الحمض النووي لأول مرة على أنها عناصر تسلسل متماثل قصير مستقل (ARS) كانت مطلوبة للنشر والحفاظ على episome. يتم تعريف كل ARS ، جزئيًا ، بواسطة منحط رابطة الدول المستقلة- عنصر تسلسل الفعل يسمى تسلسل إجماع ARS (ACS). تعد ACS ضرورية ولكنها غير كافية لوظيفة الأصل (Celniker et al. 1984) ، حيث توجد & GT 10000 مطابقة لعنصر ACS في جينوم الخميرة (Breier et al. 2004). ومع ذلك ، فإن & lt400 من تلك التطابقات المحتملة لـ ACS تعمل كمواقع ربط حسنة النية لمجمع التعرف على الأصل (ORC) (Xu et al. 2006).وبالتالي ، من المحتمل أن تشارك ميزات الكروموسومات الأخرى في تحديد أصول النسخ المتماثل.

على الرغم من الحفاظ على ORC وغيرها عبر- عوامل التأثير المطلوبة لتجميع مجمع ما قبل التكرار (قبل RC) وتحميل هليكاز Mcm2–7 في الأصل ، بدون حفظ رابطة الدول المستقلةتم تحديد العناصر الفاعلة التي توجه تكرار الحمض النووي في حقيقيات النوى الأعلى (جيلبرت 2004). على عكس في S. cerevisiae، ORC المنقى من حقيقيات النوى الأعلى يظهر القليل من خصوصية التسلسل في المختبر أو لا تظهر على الإطلاق (Vashee et al. 2003 Remus et al. 2004). قد تشير هذه النتائج معًا إلى أن اختيار الأصل وبدء النسخ المتماثل هي أحداث عشوائية أو عشوائية في حقيقيات النوى الأعلى ، ولكن العديد من الدراسات حددت أصولًا محددة للتكرار بالإضافة إلى ارتباط ORC في مواقع كروموسومية محددة وقابلة للتكاثر (Austin et al. 1999 Ladenburger et al. 2002 Karnani et al. 2010 MacAlpine et al. 2010). وبالتالي ، على عكس إشارات التسلسل التي تساهم في اختيار المنشأ في الخميرة ، يبدو أن محددات ارتباط ORC في حقيقيات النوى الأعلى تعتمد بشكل أساسي على بيئة الكروماتين المحلية.

تشير هذه النتائج معًا إلى أنه في كل من حقيقيات النوى المنخفضة والعالية ، يعد تنظيم الكروماتين المحلي وهيكله سمات مهمة لاختيار الأصل. في الواقع ، أبرزت الدراسات الحديثة في أنظمة النماذج التجريبية المتعددة دور تعديلات الهيستون وتنظيم الكروماتين في تنظيم برنامج تكرار الحمض النووي.

تعديلات هيستون وتنظيم المنشأ

التجارب في S. cerevisiae أظهر أهمية بيئة الكروماتين المحلية في تنظيم وظيفة الأصل. في الخمائر ، غالبًا ما يتم إسكات الجينات القريبة من نهايات الكروموسوم بواسطة Sir2p ، HDAC ، وعادةً ما يتم تكرارها في وقت متأخر (تمت المراجعة في Rusche et al.2003). التأخير في تنشيط المنشأ بالقرب من التيلوميرات لا ينتج عن التسلسل ، حيث أن نقل ARS501 ، وهو أصل تيلومري متأخر التنشيط ، إلى منطقة أخرى من الجينوم قد خفف من قمع التيلوميرات لتفعيل الأصل (Ferguson and Fangman 1992). بدلاً من ذلك ، فإن قمع تنشيط الأصل بالقرب من التيلومير يرجع إلى بنية الكروماتين المحلية ، وأدى تعطيل هذا الهيكل إلى تقدم إطلاق الأصل في مرحلة S (Stevenson and Gottschling 1999). في الآونة الأخيرة ، حدد التحليل على مستوى الجينوم للوقت الذي يتم فيه تكرار تسلسلات معينة في المرحلة S ارتباطًا واضحًا بنشاط النسخ وتوقيت النسخ المتماثل في الإنسان (Birney et al. 2007 Ryba et al. 2010) ، الماوس (Hiratani et 2010) ، ذبابة الفاكهة (Schübeler et al.2002 MacAlpine et al.2004) وخلايا الدجاج (Hassan-Zadeh et al. 2012). يتم تكرار مناطق الجينوم ذات الكثافة الجينية النشطة نسبيًا قبل مناطق الجينوم ذات النشاط الجيني المتناثر. إن الارتباط بين توقيت النسخ المتماثل ونشاط النسخ ليس على مستوى الجينات الفردية بل يتم تحديده من خلال النشاط النسخي الواسع لمجالات الكروموسومات الكبيرة (MacAlpine et al. 2004). ليس من المستغرب أن يكون هناك أيضًا ارتباط قوي بين تعديلات الكروماتين المرتبطة بالنسخ النشط والتكرار المبكر. وجدت التجارب المأخوذة من مشروع موسوعة عناصر الحمض النووي (ENCODE) أن التتابعات المكررة في المرحلة S المبكرة من خلايا هيلا قد تم إثرائها لتفعيل علامات الكروماتين (H3K4Me2 و H3K4Me2) بالإضافة إلى فرط الأستلة في الهيستونات H3 و H4 (بيرني وآخرون 2007) . تم الإبلاغ عن ارتباطات واسعة مماثلة بين وقت النسخ المتماثل وتنشيط تعديلات هيستون في العديد من الدراسات المستقلة من عدد من أنظمة النماذج حقيقية النواة (Hiratani et al. 2008 Schwaiger et al. 2009 Lee et al. 2010). قد يكون التنسيق الواضح بين برامج النسخ والنسخ ناتجًا جزئيًا عن التوطين المتكرر لأصول النسخ المتماثل بالقرب من مواقع بدء النسخ (Cadoret et al. 2008 Cayrou et al. 2011).

يؤثر اضطراب هيستون أستلة على برنامج النسخ المتماثل. في حالة عدم وجود Rpd3 ، HDAC ، يتم تقصير طول طور S ، على الأرجح بسبب التنشيط المبكر لمجموعة فرعية من أصول النسخ المتماثل (Vogelauer et al.2.2002). في الواقع ، أدى التحليل على مستوى الجينوم لنشاط المنشأ في غياب Rpd3 إلى التنشيط المبكر لما يقرب من 100 من أصل إطلاق النار المتأخر للنسخ المتماثل (Knott et al. 2009). كما أدت الزيادة المحلية في أستيل هيستون بوساطة ربط Gcn5 ، وهو هيستون أسيتيل ترانسفيراز ، إلى منشأ متأخر التنشيط ، إلى تعزيز بدء المنشأ بشكل كبير في مرحلة S (Vogelauer وآخرون ، 2002). لا يقتصر دور أستيل الهيستون في تعزيز النسخ المتماثل على الخميرة ، مثل تجنيد Chameau (Hbo1) ، ذبابة الفاكهة هيستون أسيتيل ترانسفيراز (انظر أدناه) ، إلى نشاط التكرار المحفز لموقع المشيمة (Aggarwal and Calvi 2004). وبالمثل ، يمكن أن يؤدي استهداف نشاط HAT أو HDAC إلى موضع B-globin إلى تغيير وقت النسخ المتماثل من متأخر إلى مبكر والعكس صحيح ، على التوالي (Goren et al. 2008). تشير هذه النتائج بوضوح إلى أن التغييرات المحلية في أستيل هيستون قادرة على ضبط نشاط الأصل بدقة.

تشير النتائج الأخيرة إلى أن مجال التماثل المجاور لـ Orc1 (BAH) يربط على وجه التحديد ليسين ثنائي الميثيل 20 من هيستون H4 (Kuo et al. 2012) أن H4K20me2 قد يكون مهمًا لتوظيف ORC للكروماتين وتحديد أصول النسخ المتماثل. تؤدي الطفرات في مجال Orc1 BAH بالإضافة إلى مكونات أخرى قبل RC إلى متلازمة Meier-Gorlin ، وهي شكل بدائي نادر من التقزم (Bicknell et al. 2011). علاوة على ذلك ، يؤدي فقدان Suv4-20h1 / h2 ، وهو ميثيل ترانسفيراز المسؤول عن H4K20me2 ، إلى عيوب تطورية مشابهة لمتلازمة ماير جورلين في أسماك الزرد ، مما يشير إلى دور حاسم في ثنائي ميثيل H4K20 وبرنامج نسخ الحمض النووي أثناء التطور الطبيعي (Kuo et al. 2012). ومع ذلك ، تجدر الإشارة إلى أن H4K20me2 هو التعديل الأكثر وفرة للهيستون ، حيث يمثل 85 ٪ من مستويات هيستون H4 في الماوس (شوتا وآخرون ، 2008). في المتوسط ​​، سيحتوي 97 ٪ من جميع النيوكليوسومات على هيستون H4K20me2 واحد على الأقل ، مما يجعل من الصعب القول بأن H4K20me2 هو عامل خصوصية لـ ORC. بدلاً من ذلك ، قد يساعد H4K20me2 ببساطة في تثبيت ORC على الكروماتين ، مع وجود ميزات كروموسومية أخرى تعمل كعوامل خصوصية أصل.

بدلاً من التأثير على توطين ORC ، تشير التجارب الجديدة إلى أن بيئة الكروماتين المحلية قد تنظم تحميل هيليكاز التكاثر في G1. Hbo1 (ارتباط هيستون أسيتيلز بـ ORC) هو عبارة عن هيستون أسيتيل ترانسفيراز وفيرة مسؤولة عن الجزء الأكبر من أستلة هيستون H4 في جينومات الثدييات وتم تحديدها في البداية بناءً على تفاعلها مع ORC و Mcm2 و Cdt1 (Iizuka and Stillman 1999 Burke et al. 2001 Iizuka وآخرون 2006). في Xenopus مقتطفات Hbo1 مطلوبة لتجميع ما قبل RC (Iizuka et al. 2006) ، والتجنيد الاصطناعي لـ Hbo1 غير وظيفي محفزًا إلى أصل ثديي للتكرار يؤثر سلبًا على تحميل Mcm2–7 هيليكاز (Miotto و Struhl 2010). ومن المثير للاهتمام ، مثل العديد من البروتينات ذات نشاط HAT ، أن Hbo1 لديه القدرة على أسيتيل البروتينات غير الهيستونية بما في ذلك Orc2 و Mcm2 و Cdc6 في المختبر (Burke et al. 2001). وبالتالي ، ليس من الواضح تمامًا ما إذا كان دور Hbo1 في تنظيم الأصول يرجع إلى الأسيتيل المحدد للهيستونات أو ، بدلاً من ذلك ، أستلة مكونات ما قبل RC.

تشير تجارب مماثلة أيضًا إلى أن مستويات مونوميثيل H4K20 مهمة في تحميل الهيلياز وتشكيل ما قبل RC (Tardat et al. 2007). Set8 ، المعروف أيضًا باسم PR-Set7 ، هو عبارة عن ميثيل ترانسفيراز منظم بدورة الخلية والذي يكون monomethylates هيستون H4 في ليسين 20 (Fang et al. 2002 Nishioka et al.2002). يستهدف Set8 البروتيازوم خلال المرحلة S بواسطة E3 ubiquitin ligase Crl4 بطريقة تعتمد على PCNA (Abbas et al. 2010 Centore et al. 2010 Oda et al. 2010). تعد مستويات Set8 ضرورية للحفاظ على الاستقرار الجيني ، حيث يؤدي فقدان وظيفة Set8 إلى تأخير المرحلة S ، وتفكيك الكروموسوم ، وزيادة تلف الحمض النووي ، و G2 الاعتقال ، والتضخيم المركزي (Karachentsev et al. 2005 Jorgensen et al.2007). وبالمثل ، فإن التثبيت والإفراط في التعبير عن Set8 يضران أيضًا بالخلية ، مما يؤدي إلى ضغط الكروماتين وإعادة التكرار (Tardat et al.2007). من المفترض أن إعادة التكرار الناجم عن تثبيت Set8 ترجع جزئيًا إلى تكوين مختلط قبل RC ، حيث لوحظت زيادة محلية في H4K20me وتوظيف مكونات ما قبل RC عندما يتم ربط Set8 بموضع معين (Tardat et al. 2007) . فهم كيفية تنظيم حالة مثيلة ليسين 20 (أحادي ، ثنائي ، أو ثلاثي الميثيل) من خلال دورة الخلية وتأثيرها على توطين ORC ، وتجميع ما قبل RC ، واستقرار الجينوم سيكون بلا شك مجالًا نشطًا وهامًا للبحث المستقبلي .

تحديد مواقع النواة واختيار المنشأ

التجارب المبكرة على حلقة تحتوي على ARS1 ، و S. cerevisiae أصل تكرار الحمض النووي ، وتحديد النيوكليوسومات ذات الموقع الجيد التي تحيط بتسلسل الأصل (Simpson 1990). تحليل مجموعات بيانات تحديد موقع النواة على نطاق الجينوم من S. cerevisiae كشفت أن جميع عناصر ARS تقريبًا قد استنفدت من النيوكليوزومات السائبة (Mavrich et al. 2008a). حدد التحليل اللاحق لموضع النوكليوزوم بالنسبة إلى اتجاه 17-bp ACS ، وليس عناصر ARS المعينة على نطاق واسع ، تحديد النيوكليوزومات الموضوعة بدقة والتي تحيط تقريبًا بجميع أصول الخميرة للتكرار (Berbenetz et al. 2010 Eaton et al. 2010). وهكذا ، يبدو أن النيوكليوسومات المتمركزة التي لوحظت لأول مرة في ARS1 على البلازميد هي السمة المميزة لـ S. cerevisiae أصول تكرار الحمض النووي. علاوة على ذلك ، لوحظ أيضًا انخفاض شغل النوكليوسوم في أصول التكرار في مجموعة متنوعة من الكائنات حقيقية النواة المختلفة خارج S. cerevisiae، بما فيها ذبابة الفاكهة (MacAlpine وآخرون 2010) ، وخلايا الثدييات (Lubelsky وآخرون 2011) ، و شيزوساكارومايس بومب (جيفنز وآخرون 2012).

النموذج الناشئ هو ذلك في S. cerevisiae، تحافظ إشارات التسلسل ACS والتسلسل المصب على منطقة الأصل خالية من التعدي على النيوكليوسومات وأن هذه المنطقة الكبيرة الخالية من النوكليوسومات تسهل توطين ORC (الشكل 4). بمجرد الارتباط ، يلزم وجود ORC ونشاط إعادة تشكيل الكروماتين المعتمد على ATP لتوليد مجموعة من النيوكليوسومات ذات الموقع الجيد التي تحيط بأصل النسخ المتماثل (Eaton et al. 2010). ومن المثير للاهتمام ، أنه إذا تم تغيير موضع النوكليوسوم المنبع ، فإن تحميل Mcm2–7 والبدء به يكون ضعيفًا ، مما يشير إلى أن بنية الكروماتين ضرورية لتجميع ما قبل RC وتفعيل الأصل (Lipford and Bell 2001). ومع ذلك ، تبقى العديد من الأسئلة الهامة. كيف يسهل تحديد موقع النواة ودورانها وطردها تحميل Mcm2–7 وتفعيل الأصل؟ ما هي أنشطة إعادة تشكيل الكروماتين المعتمدة على ATP المطلوبة ، وكيف تساهم في تنشيط المنشأ والتوقيت والكفاءة؟ فهم كيفية تأثير هيكل الكروماتين المحلي على التحديد الجيد نسبيًا وتنظيمه S. cerevisiae سيكون برنامج تكرار الحمض النووي مهمًا لفهم كيفية مساهمة بيئة الكروماتين المحلية وديناميكياتها في مرونة اختيار المنشأ في حقيقيات النوى الأعلى.

تنظيم النيوكليوسوم في أصول النسخ المتماثل. الطبيعة الغنية بـ AT لـ ACS والتسلسلات المرافقة في S. cerevisiae تمنع أصول النسخ المتماثل تعدي النيوكليوسومات في الأصل. لوحظت المنطقة الخالية من النوكليوسوم في أصول النسخ المتماثل في الخميرة وحقيقيات النوى الأعلى وقد تعمل كمحدد أساسي لربط ORC. عند ربط ORC ، تصبح النيوكليوسومات المحيطة في موضع دقيق ، ويعتمد هذا الوضع على ORC ونشاط إعادة تشكيل الكروماتين المعتمد على ATP. قد تسهل المنطقة الخالية من النوكليوسوم في الأصل تحميل العديد من مجمعات Mcm2–7 وأحداث فك الحمض النووي اللاحقة قبل البدء.


أساليب

تحليل النشوء والتطور

بحثنا في قواعد بيانات الأرز كاملة الطول (كدنا) ، NCBI [http://www.ncbi.nlm.nih.gov/] و GRAMENE [http://www.gramene.org/] ، باستخدام البرامج BioEdit (الإصدار 7.0. 5.3) و MEGA (الإصدار 3.1) لتحديد متماثلات الأرز في RecQ. تم العثور على سبعة متماثلات RecQ في الأرز. تم إجراء التحليل الوراثي بناءً على محاذاة تسلسل الأحماض الأمينية الناتجة عن برنامج CLUSTALW المدمج.

توليف OsRecQl4 (كدنا) وعزل أوسريكقل 4خطوط متحولة

تم عزل Total RNA من شتلات عمرها 7 أيام باستخدام مجموعة RNeasy Plant Mini (Qiagen) وفقًا للبروتوكول المقدم من الشركة المصنعة. تم إجراء النسخ العكسي باستخدام ReverTra Ace (Toyobo ، اليابان) وفقًا للتعليمات المقدمة من الشركة المصنعة ، مع إجمالي الحمض النووي الريبي من قاعدة تبادل الأرز. تم إجراء تفاعل البلمرة المتسلسل (PCR) والتضخيم السريع لنهايات cDNA (RACE) باستخدام بوليميراز DNA عالي الدقة ، KOD-Plus (Toyobo ، اليابان). تم إجراء 5’- و 3’-RACE باستخدام مجموعة GeneRacer (Invitrogen ، Carlsbad ، CA) مع بادئات خاصة بالجينات مصممة وفقًا لتسلسل الحمض النووي الجيني. كانت البادئات الخاصة بالجينات المستخدمة لتضخيم منطقة الترميز الخاصة بـ OsRecQl4 هي RecQl4_Start1 (GCCATGATAAAGCCAAGGGTCAACT) ، وكانت الاشعال لتضخيم cDNA كامل الطول RecQl4_End1 (ACCCTAGGCTATTCTGGCGGACTG) ، RecQTAGTAGTAGCAC4-5'RGACGAC (GCTAGAC) ، RecQL4-5'RGAC . تم استنساخ منتجات PCR في ناقل pCR2.1 TOPO (Invitrogen ، سان دييغو ، كاليفورنيا) لتسلسل الحمض النووي.

بذور خط T-DNA الموسوم أوسريكقل 4-1 وخط الإدراج Tos17 أوسريكقل4-2 تم الحصول عليها من POSTECH (السطر رقم 3A-03503) [50] ومجموعات NIAS (السطر رقم NC2763) ، على التوالي [51]. تمت زراعة البذور المشتقة من نباتات متغايرة الزيجوت في التربة ، وتم تكاثر البذور الخاصة بخطوط إدخال T-DNA و Tos17 في الدفيئة.

تم تحديد مواقع تكامل T-DNA و Tos17 بواسطة PCR باستخدام الاشعال التالية: لإدخال T-DNA ، مجموعات خاصة بالحد الأيسر أو الأيمن من T-DNA المعني: pGA2715-L1.5 (GGCCAGTGAATTCACTAGTGATTGC) ، 3A -03503-498 F (CAATCCATCCTCGAAAGGCAAT) ، 3A-03503-498R (ATTCGCGAGGCCATCTCTCT) ولإدخال Tos17: Tos17_3880 (AGTCGCTGATTTCTTCACCAAGG) ، NC2763-F (TGCCTTGTACGTGT) جين كل منها تم تنقية منتجات PCR وتسلسلها (الشكل 1A).

تحليل اللطخة الشمالية

تم تحضير إجمالي الحمض النووي الريبي (Total RNA) من أطراف إطلاق الشتلات التي يبلغ عمرها 10 أيام باستخدام مجموعة RNeasy Plant Mini Kit (Qiagen ، فالنسيا ، كاليفورنيا). تم تحميل إجمالي الحمض النووي الريبي (20 ميكروغرام) وفصله على هلام agarose بنسبة 1 ٪ ، ونقله إلى غشاء نايلون موجب الشحنة (Roche ، مانهايم ، ألمانيا). التحقيق ألف (OsRecQ4-proN_F، AACACAAAGGCCTAATCAGGAAGCA OsRecQ4-proN_R، ATTCCTGGTGTAAATCGGTGATTGG) تم إعداد أو B (RecQl4_1F، GTCGAAAAAGATGTGACCAACATTGCTAG RecQl4_1R، TCCCGTCCACTTGACTCTGTTGATTAG) (الشكل 1A) باستخدام مسبار PCR DIG تركيب طقم (روش)، وتم إجراء التهجين وفقا لطلب DIG دليل (روش). تم إجراء التهجين عند 50 درجة مئوية ، وتم إجراء الغسيل في ظروف شديدة الصرامة عند 50 درجة مئوية.

العلاج بالعوامل الضارة للحمض النووي

لدراسة تأثير العوامل الضارة بالحمض النووي على الأرز ، قمنا بإعداد مخزون 10 مجم / مل من السيسبلاتين (CDDP ، cis-diamminedichloroplatinum [II] Wako Pure Chemical Industries ، طوكيو ، اليابان) ، مخزون 10 مجم / مل من البليوميسين (BLE Wako Pure Chemical Industries) ، مخزون 10 مجم / مل من الأفيديكولين (APH Wako Pure Chemical Industries) ، ومخزون 10 مجم / مل من نوكودازول (NOC Wako Pure Chemical Industries) ، ومخزون 1 ملي مولار من كامبتوثيسين (CPT Wako Pure Chemical الصناعات).

لتحليل تأثير العوامل المدمرة للحمض النووي على استطالة الجذر ، زرعت البذور المعقمة على وسط صلب MS يحتوي على عوامل ضارة بالحمض النووي ونمت في غرفة نمو عند 30 درجة مئوية تحت ضوء مستمر. بعد خمسة أيام من الزراعة ، تم قياس طول الجذر باستخدام برنامج Image J (الإصدار 1.43).

لتحضير المواد النباتية لتلوين PI ومقايسة TUNEL ، قمنا بنقل نباتات أرز عمرها 5 أيام نمت على وسط صلب MS إلى وسط سائل MS يحتوي على تركيزات مختلفة من العوامل الضارة بالحمض النووي ثم حضنت لمدة 24 ساعة أخرى في غرفة النمو. لفحص المذنب ، تم نقل كالي البالغ من العمر 4 أسابيع الذي نمت على وسط صلب N6D إلى وسط سائل N6D يحتوي على عوامل ضارة بالحمض النووي ثم حضنت لمدة ساعة أخرى في RT.

تلطيخ PI لطرف الجذر

تم تلوين أطراف الجذر ، التي تم قطعها حوالي 10 مم من طرف الجذر ، بـ 5 مجم / لتر PI (مذاب في ماء معقم) لمدة 20 دقيقة على زجاج منزلق.

تحليل TUNEL (نيك ووسم dUTP بوساطة ديوكسينوكليوتيديل ترانسفيراز)

تم إصلاح الجذور بين عشية وضحاها بنسبة 4 ٪ (حجم / حجم) بارافورمالدهيد في PBS (الرقم الهيدروجيني 7.4) عند 4 درجات مئوية. بعد ذلك ، تم تجفيف الجذور الثابتة في سلسلة من ثلاثي البيوتانول وتم تضمينها في paraplast للتقطيع. تمت إعادة ترطيب العينات في سلسلة متدرجة من الإيثانول إلى الماء لإزالة بارافورمالدهيد ، قبل معالجتها بالبروتيناز K (20 ميكروغرام / مل بروتيناز K في 10 ملي مولار Tris-HCl ، pH 7.5) عند 37 درجة مئوية لمدة 30 دقيقة ، ثم غسلها ثلاث مرات. مرات مع برنامج تلفزيوني. تم إجراء تفاعل TUNEL على زجاج منزلق باستخدام مجموعة اكتشاف موت الخلايا في الموقع مع فلوريسئين (روش) وفقًا لتعليمات الشركة الصانعة.

فحص المذنب

تم طلاء الشرائح المجهرية بطبقة من 1٪ درجة انصهار عادية [اغروس) وتجفيفها جيدًا. تم تقطيع Calli في 200 ميكرولتر PBS تحتوي على 50 ملي EDTA بشفرة حلاقة. تم خلط 30 ميكرولتر من المعلق الناتج من النوى مع حجم متساوٍ من سائل أغاروز منخفض نقطة الانصهار 1٪ عند 42 درجة مئوية وانتشر على شرائح مجهرية مطلية مسبقًا بـ 1٪ من agarose نقطة انصهار عادية. بعد تجميد النوى المحتوية على الاغاروز ، تعرضت النوى لتحلل في محلول ملح عالي (2.5 مولار كلوريد الصوديوم ، 10 ملي مولار من حمض الهيدروكلوريك Tris-HCl 7.5 ، 100 ملي مولار EDTA) لمدة 20 دقيقة عند درجة حرارة الغرفة. تمت الموازنة لمدة 3 × 5 دقائق في 1 × TBE على الجليد بالرحلان الكهربي عند درجة حرارة الغرفة في محلول مؤقت 1 × TBE لمدة 6 دقائق. لإزالة المواد الهلامية من حبيبات النشا الموجودة في المعلق النووي ، تم الاحتفاظ بالشرائح لمدة 10 دقائق في 1٪ Triton قبل الجفاف لمدة 2 × 5 دقائق في 70٪ إيثانول و 96٪ إيثانول وتجفيف بالهواء. تم تلوين مواد هلامية الاغاروز الجافة مع 1: 10000 SYBR مخفف باللون الأخضر. بعد التلوين ، تم التقاط الشرائح تحت مجهر الفلورسنت باستخدام برنامج مجهر Leica DM5000 وتم تحديد كمية تلف الحمض النووي باستخدام برنامج CometScore ™.

المجهر

تم التقاط صور لنصائح الجذر الملطخة بـ PI بواسطة مجهر Keyence (BZ-9000) بوظيفة Z-stack. تقوم وظيفة Z-stack بتحريك النقطة المحورية للعدسة الموضوعية عبر المحور Z ، والتقاط العديد من الصور ، واستخراج النقاط المركزة فقط من الصور ، وتوليف النقاط في صورة متعددة البؤرة (http: //www.keyence. com / products / microscope / fluorescence / bz8000 / bz8000_features_3.php). تم استخدام مجهر Leica DM5000 أيضًا لالتقاط الصور.

تحول الأرز

أجروباكتريوم- تحويل الأرز بوساطة (يا ساتيفا سيرة ذاتية. Nipponbare) كما هو موصوف سابقًا [52 ، 53]. تم تعقيم البذور المقشرة وإنباتها على وسط N6D لمدة أسبوع. بعد الزراعة المشتركة لـ أجروباكتريوم يحمل ناقل pGU. تم نقل الكالي إلى وسط N6D يحتوي على مضادات حيوية مناسبة لاختيار الخلايا المحولة. تم نقل Calli التي نمت بقوة على وسط الاختيار إلى وسط تجديد يحتوي على مضادات حيوية. تمت زراعة النباتات المجددة على وسط MS خالي من الهرمونات ، ثم زرعت في التربة.

تلطيخ GUS الكيميائي

تم إجراء تلطيخ كيميائي نسجي للمواد النباتية كما وصفه جيفرسون [54]. لتسهيل تغلغل عازلة التلوين ، تم تقطيع النباتات إلى شرائح بحجم 10 ملم تقريبًا ، وتم تقسيم كالي كبير إلى عدة قطع. تم اختراق هذه المواد النباتية بالفراغ باستخدام ركيزة تلطيخ X-Gluc لمدة 3 × 10 دقائق ثم تم تحضينها عند 37 درجة مئوية لمدة 3 أيام. تم تبييض Calli لاحقًا باستخدام 70 ٪ من الإيثانول وتم حساب عدد البقع الزرقاء GUS.


شاهد الفيديو: Cannot change Word language on windows - Fix language doesnt change while set correctly (شهر نوفمبر 2022).