معلومة

لماذا أحصل على السيتوزين إلى انتقالات الجوانين / الأدينين في التسلسلات المعالجة بالبيسلفيت؟

لماذا أحصل على السيتوزين إلى انتقالات الجوانين / الأدينين في التسلسلات المعالجة بالبيسلفيت؟


We are searching data for your request:

Forums and discussions:
Manuals and reference books:
Data from registers:
Wait the end of the search in all databases.
Upon completion, a link will appear to access the found materials.

لقد حصلت على نتائج التسلسل الخاصة بي (متواليات تمت معالجتها باستخدام ثنائي الكبريتيت وغير معالج من نفس النوع Allium cepa) والآن يتعين علي إجراء تحليل باستخدام أداة Cymate عبر الإنترنت. لقد أعددت جميع التسلسلات كما هو مكتوب في ورق Cymate الأصلي (التسلسل الرئيسي والمستنسخات - المحاذاة في ClustalW ، منتهية غير حادة).

مشكلتي هي أنني حصلت على فجوات في النتائج (الصورة مرفقة ، إنها من Cymate Result) في المواضع 27 ، 50 ، 58 إلخ. عندما نظرت إلى ملف FASTA الأصلي الخاص بالمحاذاة وقارنت تلك المواضع ، لاحظت أن هذه الفجوات هي من C إلى A ، أو C إلى G انتقالات (ومن الواضح أن مخرجات Cymate فقط من C إلى C ، و C إلى T حالات).

هل يعرف أي شخص لماذا أحصل على C إلى A ، أو C إلى G ، هذه بعض حالات عدم التطابق ، هل يجب إزالتها يدويًا من المحاذاة ، أم أنني ارتكبت خطأً آخر؟

أي نصيحة منك ستكون مفيدة للغاية بالنسبة لي!

محاذاة ملف FASTA الخاص بي ، الذي قمت بتحميله إلى Cymate ، موجود هنا (إذا أراد أي شخص التحقق). التسلسل الأول هو التسلسل الرئيسي (تسلسل غير معالج ، أو تسلسل أصلي) والباقي عبارة عن نسخ (متواليات معالجة بالبيسلفيت).

Consensus_cepa __ (289_bp) GAAAGCCAACCACCACATCCGCCATCCCTCACAGTATGCCAACGAGCAGCTGAATGACTCCGAACAACGCAAAGCATGACGCCCAAACCGACGAACACCCAACCGAAAGGCCACAAGCGCAACGTGCATTCCAAAACCCCATGAACCACCGAATCCTGCAATGCACACCACGCTCGACGCCATTCGCTACAGACCACATCGACACGAGCGCCAAGCCATCCATCACCCGAAGCCATCCACCCACTCACAAACATACCACGAAGCACAGCAAATATGAAGACAAACCCTC MV_A_SP6_izrezani_s_primerima __ (295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATAACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGAAATTCTGCAATTCACACCAAA - TATTGCATTTCGCTACGTTCTTCATCGACACGAAAACCAAAATATCCATTGCCAAAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC MV_B_SP6_izrezani_s_primerima __ (295_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAGATAAATAA-TTAAAATGACGCAAAACATAACGCCCAAACAGACGTACTCTCAACCTAATGACCTTGAACGCAACTTACATTCAAAAACTCGATGATTCACGGAATTCTGCAATTCACACCAAA - TATCACATTTCGCTACGTTCTTCATCAACACGAAAACCAAAATATCCATTACCAGAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC MV_C_SP6_izrezani_s_prime ريما __ (291_bp) AAAAATCAATCTCCACATCCGCCATCACTCACAGTATATTTAC-AGTAAATAAATAA-TTAAAATAACGCAAAACATGACACCCAAACAGACATACTCTCAACCTAATAACCTCGAACGCAACTTACATTCAAAAACTCGATAATTCACGGAATTCTGCAATTCACACCAAA - TATCGCATTTCGCTACGTTCTTCATCGACACGAGAACCAAAATATCCATTGCCAGAAATCATTCAGACGCTCACTGAAATAACACAAAACACATCAAA-ATAATAACAAACTTTC


لقد قمت بمحاذاة التسلسلات الخاصة بك بسرعة ، وبقدر ما أستطيع أن أقول ، فإن الإجابة هي أن تسلسل "الإجماع" الخاص بك هو تطابق ضعيف مع التسلسلات الثلاثة الأخرى:

كلوستال شكل المحاذاة التي كتبها MAFFT L-INS-ط (v7.310) Consensus_cepa_ gaaagccaaccaccacatccgccatccctcacagtatgccaacgagcagctgaatgactc MV_A_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-TT MV_C_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtaaataaataa-TT MV_B_SP6_izreza aaaaatcaatctccacatccgccatcactcacagtatatttac-agtagataaataa-ترينيداد وتوباغو. *** ... ***. * ***** ********* **********… ** **. *. *. ***. * *. Consensus_cepa_ cgaacaacgcaaagcatgacgcccaaaccgacgaacacccaaccgaaaggccacaagcgc MV_A_SP6_izreza aaaataacgcaaaacataacgcccaaacagacgtactctcaacctaataacctcgaacgc MV_C_SP6_izreza aaaataacgcaaaacatgacacccaaacagacatactctcaacctaataacctcgaacgc MV_B_SP6_izreza aaaatgacgcaaaacataacgcccaaacagacgtactctcaacctaatgaccttgaacgc. ** ... *******. ***. **. ******* ***. ** * ***** ** ... ** ... *. *** Consensus_cepa_ aacgtgcattccaaaaccccatgaaccaccgaatcctgcaatgcacaccacgctcgacgc MV_A_SP6_izreza aacttacattcaaaaactcgataattcacgaaattctgcaattcacaccaaatattgcat MV_C_SP6_izreza aacttacattcaaaaactcgataattcacggaattctgcaattcacaccaaatatcgcat MV_B_SP6_izreza aacttacattcaaaaactcgatgattcacggaattctgcaattcacaccaaatatcacat *** * ***** ***** * **. *. ***. ***. ******* ******* ... * ... Consensus_cepa_ cattcgctacagaccacatcgacacgagcgccaagccatccatcacccgaagccatccac MV_A_SP6_izreza --ttcgctacgttcttcatcgacacgaaaaccaaaatatccattgccaaaaatcattcag MV_C_SP6_izreza --ttcgctacgttcttcatcgacacgagaaccaaaatatccattgccagaaatcattcag MV_B_SP6_izreza --ttcgctacgttcttcatcaacacgaaaaccaaaatatccattaccagaaatcattcag ********. *. ****. ****** ****** ... **** ... ... **. ** ... *** ** Consensus_cepa_ ccactcacaaacataccacgaagcacagcaaatatgaagacaaaccctc MV_A_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc MV_C_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc MV_B_SP6_izreza acgctcactgaaataacacaaaacacatcaaa-ataataacaaactttc *. *****. * *** ***. **. **** **** **. *. ******… **

أود أن أقترح محاولة التوصل إلى توافق / تسلسل مرجعي مختلف وأكثر ملاءمة. هذا لا يبدو أنه مناسب.

صحيح ، ليس لدي أي فكرة عن كيفية توصلك إلى هذا التسلسل الإجماعي (بالتأكيد ليس إجماعًا على التسلسلات الأخرى التي تظهرها) ، وربما هناك شيء آخر يحدث لم أفهمه.

لا يبدو أن هذا له أي علاقة بتحويل ثنائي السلفيت ، حيث تشتمل البيانات أيضًا على تغييرات لا يمكن أن تُعزى إلى بيسلفيت ، فجوات ، إلخ.

معرفة المزيد عن سير العمل بأكمله من شأنه أن يساعد.

تحديث

أيضًا ، على الرغم من أنني لست على دراية بسير العمل ، فهل يمكن ألا تكون هذه الفجوات مرتبطة بالمثيلة على الشريط المقابل؟ على سبيل المثال CGTA -> TACG.

هل هناك سياق مثيلة معين تنظر إليه؟ CpGs فقط؟

في بعض الحالات ، يوجد دعم للمتغيرات الغريبة (على سبيل المثال ، الإجماع ليس مجموعة خارجية).

إذا كانت البيانات مزعجة ، فمن الأفضل دائمًا فحص الآثار مباشرة.


الفصل الثامن عشر: طفرة وإصلاح الحمض النووي

- الطفرة الصامتة: يغير كودون إلى كودون مرادف يحدد نفس الحمض الأميني ، ويغير تسلسل الحمض النووي دون تغيير تسلسل الأحماض الأمينية:
* هناك بعض تأثيرات النمط الظاهري منها:
- يستخدم الحمض الريبي النووي النقال (tRNA) لمرادفات مختلفة كودون (يؤثر على معدل تخليق البروتين)
- تقاطعات exon-intron التي تؤثر على الربط
- ربط miRNAs بالتسلسل التكميلي في mRNA ، والذي يحدد ما إذا كان mRNA قد تمت ترجمته
- الطفرة المحايدة: طفرة خاطئة تغير تسلسل الأحماض الأمينية للبروتين ولكنها لا تغير وظيفتها بشكل كبير

- حامض النيتروز: يزيل أمين السيتوزين ويخلق اليوراسيل
- طفرة انتقالية

3 أكواد هراء: UGA UAA و UAG

GGA (لـ Gly) سيتحول إلى كودون لا معنى له يستبدل U بـ G
GGA & gt & gt UGA

ب) إذا حدث تحويل واحد في كودون يحدد Phe ، فما هي الأحماض الأمينية
يمكن تحديدها من خلال التسلسل المتحور؟

ج) إذا حدث انتقال واحد في كودون يحدد Leu ، فما الأحماض الأمينية يمكن
يتم تحديدها من خلال التسلسل المتحور؟

UUU: CUU (Leu) UCU (Ser) UUC (Phe)
UUC: CUC (Ser) UCC (Ser) UUU (Phe)

ب) UUU: AUU (Ile) ، UAU (Tyr) ، UUA (Leu) ، GUU (Val) ، UGU (Cys) ، UUG (Leu)

UUC: AUC (Ile) ، UAC (Tyr) ، UUA (Leu) ، GUC (Val) ، UGC (Cys) ،
UUG (ليو)

ج) CUU: UUU (Phe) ، CCU (Pro) ، CUC (Leu)
CUC: UUC (Phe) ، CCC (Pro) ، CUG (Leu)
CUA: UUA (Leu)، CCA (Pro)، CUU (Leu)
CUG: UUG (Leu) ، CCG (Pro) ، CUA (Leu)
UUG: CUG (Leu) ، UCG (Ser) ، UUA (Ser)
UUA: CUA (Leu)، UCA (Ser)، UUG (Leu)

د) UUA: AUA (Met)، UAA (Stop)، UUU (Phe)، GUA (Val)، UGA
(توقف) ، جامعة كاليفورنيا (Phe)

UUG: AUG (Met)، UAG (Stop)، UUU (Phe)، GUG (Val)، UGG (Trp)، UUC (Phe)

CUU: GUU (Val) ، CGU (Arg) ، CUG (Leu) ، AUU (Ile)
CUC: AUC (Ile) ، CAC (His) ، CUA (Leu) ، GUC (Val) ، CGC (Arg) ، CUG (Leu)

CUA: AUA (Ile) ، CAA (Gln) ، CUC (Leu) ، GUA (Val) ، CGA (Arg) ، CUG (Leu)

تسلسل قالب الحمض النووي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
عدد النوكليوتيدات: 24 نيوكليوتيدات (1 @ T 3 'و 24 عند T 5')

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGC AAU CAA CUA UAU UGA-3 '

تسلسل الأحماض الأمينية: Amino-Met Thr Gly Asn Gln Leu Tyr Stop-Carboxyl

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG CCG TCA GTT GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGC AGU CAA CUA UAU UGA-3 '

الأحماض الأمينية: Amino-Met Thr Gly Ser Gln Leu Tyr-Carboxyl

ب) ينتج عن الانتقال تكوين كودون لا معنى له لـ UAA.

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG CCG TTA ATT GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGC AAU UAA CUA UAU UGA-3 '

تسلسل الأحماض الأمينية: Amino-Met Thr Gly Asn-Carboxyl

ج) ينتج عن حذف النوكليوتيدات الواحدة طفرة انزياح الإطارات.

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG CGT TAG TTG ATA TAA CT-5 '
تسلسل mRNA: 5'-AUG ACC GCA GUC AAC UAU AUU GA-3 '

الأحماض الأمينية: Amino-Met Thr Ala Ile Asn Tyr Ile -Carboxyl

د) ينتج عن التحويل استبدال His بـ Gln في البروتين.

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG CCG TTA GTA GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGC AAU CAU CUA UAU UGA-3 '
الأحماض الأمينية: Amino-Met Thr Gly Asn His Leu Tyr-Carboxyl

التسلسل المتحور: 3'-TAC TGG CCG TTA GTG GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGC AAU CAC CUA UAU UGA-3 '
الأحماض الأمينية: Amino-Met Thr Gly Asn His Leu Tyr-Carboxyl

هـ) تؤدي إضافة النوكليوتيدات الثلاثة إلى إضافة Thr إلى الأمينو
التسلسل الحمضي للبروتين ، وهو عبارة عن إدخال داخل الإطار.

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG TGG CCG TTA GTT GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC ACC GGC AAU CAA CUA UAU UGA-3 '

الأحماض الأمينية: Amino-Met Thr Thr Gly Asn Gln Leu Tyr-Carboxyl

و) يحتفظ البروتين بتسلسل الأحماض الأمينية الأصلية.

التسلسل الأصلي: 3'-TAC TGG CCG TTA GTT GAT ATA ACT-5 '
التسلسل المتحور: 3'-TAC TGG CCA TTA GTT GAT ATA ACT-5 '
تسلسل mRNA: 5'-AUG ACC GGU AAU CAA CUA UAU UGA -3 '


خيارات الوصول

احصل على الوصول الكامل إلى دفتر اليومية لمدة عام واحد

جميع الأسعار أسعار صافي.
سيتم إضافة ضريبة القيمة المضافة في وقت لاحق عند الخروج.
سيتم الانتهاء من حساب الضريبة أثناء الخروج.

احصل على وصول محدود أو كامل للمقالات على ReadCube.

جميع الأسعار أسعار صافي.


BIOL 3500: طفرات الحمض النووي

يتم تكوين شكل موقع نشط مناسب بسبب 2 من الأحماض الأمينية التي لها شحنة معاكسة تجذب (Glu الذي يحتوي على - شحنة و Arg الذي يحتوي على + شحنة) طفرة في Arg إلى حمض أميني غير مشحون ينتج عنه شكل موقع نشط غير صحيح آخر ينتج عن طفرة حمض أميني قريب من غير مشحون إلى + شحنة (Lys) شكل موقع نشط مناسب تقريبًا بحيث يمكن أن يعمل حتى مع وجود طفرتين
(يمكن لخطأين في بعض الأحيان تصحيح الخطأ؟)

اختبار أميس: يستخدم سلالات الفاحص البكتيرية للكشف عن المطفرات الكيميائية

السابق. خلايا السالمونيلا التي هي أكسوتروف هيستيدين
(حساسة للطفرة بواسطة المواد الكيميائية)
- إضافة الطفرات المشتبه بها إلى الخلايا
- إذا كان الطفرة الطفرية: الطفرة العكسية ستنتج مستعمراته الأولية
- إذا لم يكن مطفراً: لا يوجد نمو (لا يمكن العودة إلى WT)
* اختبارات لمعرفة ما إذا كانت مادة كيميائية مطفرة عن طريق الاختبار لمعرفة ما إذا كانت ستحولها إلى مواد أولية عند إضافتها إلى الهيستيدين auxotrophs (لم يكن بوسعها البقاء على قيد الحياة قبل توفير الهيستيدين ، ثم بعد حدوث طفرة)

Auxotrophs: تتطلب مادة كيميائية غير قادرة على التخليق في وسط النمو

العديد من المواد الكيميائية لا تسبب الطفرات نفسها ولكنها تتحول إلى مطفرات عن طريق مسارات إزالة السموم الأنزيمية في الكبد

1. أضف إنزيم الكبد (مستخلص S9)
2. أضف مادة كيميائية اختبارية إلى منتصف اللوح - متوسط ​​بدون الهيستيدين
3. التحكم السلبي:
صفيحة تحتوي على مذيب غير طفري - عدد قليل من المستعمرات بها طفرات تلقائية
4. عدد المستعمرات الراجعة يقيس فاعلية الطفرات (يتم تطبيق المادة الكيميائية الاختبارية فقط على منتصف الصفيحة التي تفتقر إلى الهيستيدين - والنتيجة الإيجابية هي عندما تكون هناك كمية كبيرة من الخلايا المرتدة المعروفة باسم تلك التي كانت قادرة على البقاء على قيد الحياة بسبب طفرة تحيط بـ الوسط حيث تمت إضافة مادة كيميائية الاختبار إذا كانت كمية صغيرة وليس الوسط المحيط ، كانت سلبية وتلك التي نجت كانت من طفرات عفوية ، وليست المادة الكيميائية التي تعمل كطفرات)

الأفراد العاديون:
- تحتوي بعض الجينات ومواقع كروموسوم الأمبير على مناطق بها تكرارات ثلاثي النوكليوتيد
- تنتقل التسلسلات من الأب إلى النسل بدون طفرة
* الأفراد العاديون لديهم هذه الأشياء ، ولكن كم هو المهم

عندما يزداد عدد متواليات تكرار ثلاثي النوكليوتيدات ، فقد يتسبب ذلك في حدوث طفرات

تنتج اضطرابات TNRE عندما يزيد رقم النسخ المتكرر فوق الحجم الحرج (يتوسع تكرار الموقع بشكل متكرر)
* هناك نطاق طبيعي ونطاق مرض (حرج) لكل تسلسل ثلاثي النوكليوتيد

2. تعتمد الشدة على الميراث من الأم أو الأب (مدى احتمالية التوسع إلى المزيد من التكرارات في الأجيال القادمة)
السابق.
- HD: من المحتمل أن يكون TNRE إذا كان الميراث من الأب
- تزداد احتمالية تفاقم الحثل العضلي العضلي إذا كان من الأم

3. سبب غير مفهومة جيدا

4. زيادة التكرارات يغير بنية الحمض النووي (تشكيل الحلقة الجذعية)

الأسباب الشائعة / الوصف

1. إعادة التركيب غير الطبيعي - قد يتسبب العبور غير الطبيعي في عمليات الحذف والازدواجية والانتقال والانعكاس

2. الفصل غير السليم - قد يؤدي الفصل غير الطبيعي للكروموسومات إلى اختلال الصيغة الصبغية أو تعدد الصبغيات

3. أخطاء تكرار الحمض النووي - قد يتسبب خطأ بوليميريز الحمض النووي في حدوث طفرة نقطية

4. منتجات التمثيل الغذائي السامة - قد تكون منتجات عمليات التمثيل الغذائي العادية عوامل كيميائية تفاعلية
يمكن أن يغير بنية الحمض النووي


الملخص

شهدت السنوات القليلة الماضية انفجارًا في الاهتمام بالوراثة اللاجينية للسرطان. كان هذا نتيجة كل من الاندماج المثير لحقول الكروماتين وحقول مثيلة الحمض النووي ، وإدراك أن تغيرات مثيلة الحمض النووي متورطة في الأورام الخبيثة البشرية. أدى انتشار تغيرات مثيلة الحمض النووي في كل مكان إلى فتح الطريق أمام مجموعة من الاستراتيجيات التشخيصية والعلاجية المبتكرة. تشهد التطورات الحديثة على الوعد الكبير لعلامات مثيلة الحمض النووي كأدوات مستقبلية قوية في العيادة.


البروتينات التي ترتبط بتسلسل DNA محدد للتحكم في نسخ المعلومات الجينية من الحمض النووي إلى الحمض النووي الريبي.

مثيلة الحمض النووي التي تحمي البكتيريا من إنزيمات نوكلياز المقيدة ، مما يوفر آلية دفاع ضد غزو العاثيات والفيروسات.

مناطق الحمض النووي التي تقع بالقرب من مواقع بدء النسخ والتحكم في بدء النسخ.

العناصر الجينية التي يتم نسخها إلى الحمض النووي الريبي ، ثم يتم نسخها عكسيًا إلى الحمض النووي وإدخالها في الجينوم.

علامة فوق جينية لنسخة واحدة من الجين (من الأم أو الأب) تضمن التعبير الجيني بطريقة خاصة بالوالدين من أصل معين.

إسكات الجينات من الينقولات بواسطة الآليات اللاجينية ، بما في ذلك مثيلة الحمض النووي وتأثير الحمض النووي الريبي الصغير غير المشفر ، والذي يمنع النسخ ويضمن استقرار الجينوم.

التعديلات الكيميائية اللاحقة للترجمة لبقايا الأحماض الأمينية على هيستون.

البروتينات التي تتحكم في الوصول إلى المعلومات الجينية إما عن طريق إحداث تعديلات هيستون أو استخدام الطاقة لتغيير تفاعلات هيستون مع الحمض النووي.

(CGIs). المناطق ذات الكثافة العالية من ثنائي النوكليوتيدات السيتوزين والفوسفات والجوانين (CpG).

الخلايا التي يمكن أن تتمايز إلى أي نسيج آخر في الجسم.

المناطق التنظيمية للجينوم التي تتميز بتعديلات هيستون وتعزز نسخ الجينات المرتبطة بها عندما ترتبط بعوامل النسخ.

(BER). آلية خلوية تزيل الآفات القاعدية الصغيرة الناتجة عن قواعد الحمض النووي غير المتطابقة أو المعدلة من الحمض النووي.

مركب من ثمانية بروتينات يتكون من ثنائيات هيستون H2A-H2B واثنين من ثنائيات هيستون H3-H4 التي تشكل معًا لب الجسيم النووي.

نوع من خلايا الدم البيضاء أساسي لجهاز المناعة التكيفي.

عملية تقوم من خلالها الخلايا البائية بإعادة ترتيب أجزاء من موضع السلسلة الثقيلة للجلوبيولين المناعي لتكوين أجسام مضادة بخصائص مختلفة.

تسلسلات النوكليوتيدات المتكررة التي تحمي نهايات الكروموسومات.

التسلسلات التي تحدث عدة مرات في جميع أنحاء الجينوم.

إنزيم يحفز نسخ الحمض النووي إلى الحمض النووي الريبي.

محول RNA وحامل للأحماض الأمينية يساعد على فك شفرة mRNA لترجمته إلى تخليق البروتينات.

الإنزيمات التي تقطع الحمض النووي في روابط الفوسفوديستر الذاتية.

يؤدي انشقاق الحمض النووي في رابطة الفوسفوديستر إلى التخلص من بقايا 3′-فوسفات.

يؤدي انشقاق الحمض النووي في رابطة الفوسفوديستر إلى التخلص من بقايا 5′-فوسفات.

أنظمة التكرارات القصيرة المتناوبة (CRISPR) المجمعة بانتظام

أنظمة تحرير الجينوم ، مثل CRISPR-Cas9 ، التي تعتمد على آلية دفاع جرثومي ضد الفيروسات تتضمن تسلسلات متكررة للحمض النووي تحتوي على أجزاء من الحمض النووي الفيروسي. من خلال معالجة أنظمة كريسبر ، يمكن قطع الحمض النووي في الموقع المطلوب ، مما يسمح بإزالة الجينات أو إضافتها.

المؤثرات مثل المنشط النسخ

(حكايات). البروتينات التي يمكن برمجتها لاستهداف تسلسلات معينة من الحمض النووي في الجينوم.


معلومة اضافية

رموز الانضمام: تم إيداع الإحداثيات التالية في بنك بيانات البروتين RCSB. GRE-GRDBD هو مجمع GRDBD و GRE (معرف PDB: 5EMQ) ، smGRE-GRDBD هو مجمع GRDBD و smGRE (معرف PDB: 5EMC) ، mmGRE-GRDBD هو مجمع GRDBD و mmGRE (معرف PDB: 5EMP). يمكن تنزيل بيانات BisChIP-seq من المركز الوطني لمعلومات التكنولوجيا الحيوية GEO (GSE64171).

كيفية الاستشهاد بهذه المقالة: جين ، ج. وآخرون. آثار مثيلة السيتوزين على عوامل النسخ العامة. علوم. اعادة عد. 6، 29119 دوى: 10.1038 / srep29119 (2016).


دعم المعلومات

جدول S1. تركيز عينات الحمض النووي قبل معالجة بيسلفيت.

تركيز عينات الحمض النووي غير المعالجة التي تم الحصول عليها من PBMCs لخمسة متبرعين قبل علاج بيسلفيت المقاسة بواسطة Qubit dsDNA BR (مجموعة واسعة) الفحص.

الجدول S2. كمية إدخال الحمض النووي لمعالجة بيسلفيت وتركيز عينات الحمض النووي بعد معالجة بيسلفيت.

عولجت قسمتان من جميع عينات الحمض النووي الخمس مرتين مستقلتين ، مما أسفر عن عشر عينات معالجة بيسلفيت ، وبعد ذلك ، تم تجميع العينات المكررة. يتم إجراء قياسات القياس الكمي في نسختين مع مجموعة Qubit ssDNA Assay ، والبيانات المعروضة هي متوسطات ± SD لهذه التركيزات العشرة.

جدول S3. قيم Cq وترتيب تجارب qPCR من أزواج التمهيدي الستة المستخدمة.

أولاً تم حساب متوسط ​​التكرارات التقنية الثلاثة لجميع العينات الخمس. البيانات المقدمة هي المتوسط ​​الهندسي لمتوسط ​​القيم المأخوذة من عينات المانحين الخمسة. الحمض النووي الجينومي هو قياس الحمض النووي غير المعالج ، والذي يتم إجراؤه فقط للبادئات الخالية من السيتوزين نظرًا لأنها تتمتع بنفس الكفاءة قبل العلاج وبعده. يتم ترتيب المجموعات المختلفة حسب قيم Cq لكل زوج من البرايمر (الترتيب في الجدول). بعد ذلك ، يتم حساب متوسط ​​هذه التصنيفات لتقييم الترتيب النهائي. هذا هو الترتيب الوارد في الجدول 1.

جدول S4. نتائج وترتيب تجارب dPCR من أزواج التمهيدي الثلاثة التي تم استخدامها.

أولاً ، تم حساب متوسط ​​التكرارات التقنية وتطبيعها مع إدخال الحمض النووي لجميع العينات الخمس. البيانات المعطاة هي المتوسط ​​الهندسي لمتوسط ​​القيم من جميع عينات المانحين الخمسة. يتم ترتيب المجموعات المختلفة حسب كمية النسخ لكل نانوغرام ثنائي كبريتات الحمض النووي المعالج لكل زوج من التمهيدي (الترتيب في الجدول). بعد ذلك ، يتم حساب متوسط ​​هذه التصنيفات لتقييم الترتيب النهائي. هذا هو الترتيب النهائي الوارد في الجدول 1.

جدول S5. النسب المئوية لفقدان الحمض النووي الكلي في العينات.

يتم تقييم فقدان الحمض النووي بواسطة dPCR قبل وبعد معالجة بيسلفيت. يقيس هذا dPCR النسخ السليمة لأطوال معينة موجودة في العينات. للحصول على المتوسطات الواردة في الجدول ، تم حساب متوسط ​​التكرارات التقنية قبل وبعد معالجة بيسلفيت. تم استخدام هذه المتوسطات لحساب متوسط ​​الخسارة لكل مجموعة لجميع عينات المانحين الخمسة. بعد ذلك ، تم حساب المتوسطات الهندسية والانحرافات المعيارية عن هذه المتوسطات.

الجدول S6. كفاءات التحويل ونسبة المثيلة الإجمالية للمجموعات المختلفة.

يتم الحصول على البيانات من خلال تسلسل المجموعات الثمانية التي حققت أفضل أداء في تقييمات التجزئة السابقة. تم استخدام عينة واحدة من أصل خمس عينات من الجهات المانحة ، وتم تسلسل منتجين منفصلين من PCR: amplicons CFP2 و CCP3. تحسب CFP2 (414 نقطة أساس) 62 درجة مئوية ، منها 2 CpGs CCP3 (476 نقطة أساس) تحسب 159 درجة مئوية ، منها 32 CpGs.

الجدول S7. بروتوكول التحويل لدرجات حرارة مختلفة لـ Epitect (المجموعة 10).

اتبعت البروتوكولات المختلفة جدولًا زمنيًا ثابتًا كما هو منصوص عليه في دليل الشركة المصنعة. بروتوكول درجة الحرارة 3 هو نفس البروتوكول المقدم من قبل الشركة المصنعة.

جدول S8. بروتوكول التحويل لجداول زمنية مختلفة لـ Epitect (المجموعة 10).

اتبعت البروتوكولات المختلفة دائمًا مخطط درجة الحرارة على النحو المنصوص عليه في دليل الشركة المصنعة. بروتوكول الوقت 3 هو نفس البروتوكول المقدم من قبل الشركة المصنعة.

الجدول S9. التركيز بعد الشطف باستخدام Epitect (المجموعة 10) مع بروتوكولات الوقت ودرجة الحرارة المختلفة كما هو موضح في جداول S7 و S8.

في نهاية البروتوكول ، تم إجراء 2 من نفس العينة (على النحو الموصى به من قبل الشركة المصنعة لتعظيم العائد من الحمض النووي). البيانات المقدمة هي قياس واحد للمتبرع المستخدم في تجارب الوقت ودرجة الحرارة هذه.

جدول S10. تسلسل التمهيدي ودرجات حرارة التلدين لـ qPCR و dPCR.

S1 التين.

محلل حيوي (قطع علوية) وتحليل كهربائي للهلام (قطع سفلية) لمجموعات مختلفة. تُظهر المخططات الموضحة في هذا الملحق بيانات الرحلان الكهربائي لعينات المتبرعين الخمسة.

شكل S2 مقارنة بين تحليلات الاسترداد المختلفة (أحمر: Qubit مقابل أسود: dPCR).

يعتمد هذا الاسترداد على مقدار فقد الحمض النووي الكلي في العينات كما هو موضح في جدول S5.

S3 Fig. qPCR تحليل البروتوكولات البديلة من مجموعة Epitect Bisulfite كما هو موضح في جداول S7 و S8.

اللوحة العلوية: تغير البروتوكول في درجة حرارة التحويل (جدول S7). اللوحة السفلية: تم تغيير البروتوكول في وقت التحويل (جدول S8). يتم إعطاء النتائج كقيم Cq ± SD.

S4 الشكل. تحليل dPCR للبروتوكولات البديلة من مجموعة Epitect Bisulfite كما هو موضح في جداول S7 و S8.

اللوحة العلوية: تغير البروتوكول في درجة حرارة التحويل (جدول S7). اللوحة السفلية: تم تغيير البروتوكول في وقت التحويل (جدول S8). النتائج معطاة بعدد النسخ السليمة لكل نانوغرام ثنائي كبريتات الحمض النووي المعالج بواسطة dPCR ± SD.

S5 التين.

مثال على منحنيات الانصهار (اللوحة العلوية) ونتائج Caliper LabChip GX (اللوحة السفلية) بعد qPCR تظهر منحنيات انصهار محددة ، ولكن نطاقات محددة لنفس التفاعل: CCP1_after.

S6 التين.

مثال على منحنيات الانصهار (اللوحة العلوية) ونتائج Caliper LabChip GX (اللوحة السفلية) بعد qPCR تظهر منحنيات انصهار محددة ، ولكن نطاقات محددة لنفس التفاعل: CCP2_after.

مجموعة البيانات S1. بيانات التسلسل المستخدمة لكفاءة التحويل.

ملفات Fastq لبيانات التسلسل التي تم استخدامها لحساب كفاءة التحويل.


مناقشة

تلعب مثيلة الحمض النووي دورًا محوريًا في التطور وتمايز نسب الخلايا في النباتات والحيوانات [١ ، ٣-٦]. في حين أن معرفتنا بمسارات مثيلة الحمض النووي في الحيوانات والنباتات والفطريات متطورة نسبيًا ، إلا أنه لا يُعرف سوى القليل جدًا عن مثيلة الحمض النووي في الكائنات الحية الدقيقة eukar-yotes ، مثل ciliates. على الرغم من أن العمل المبكر فشل بشكل موحد في تحديد مثيلة السيتوزين في باراميسيوم أوريليا ، تي ثيرموفيلا، أو O. trifallax [73-75] ، حددنا هنا كلاً من ميثيل سيتوزين وهيدروكسي ميثيل سيتوزين كلاعبين أساسيين في عملية إعادة ترتيب الجينوم O. trifallax. لقد حددنا هذه التعديلات بشكل لا لبس فيه باستخدام UPLC-MS عالي الحساسية لتدفق النانو ، واختبرنا وظائفها عن طريق منع تكوينها باستخدام مثبطات ميثيل ترانسفيراز. لأن العمل السابق فحص عينات نباتية من O. trifallax، والتي نؤكد أنها تفتقر إلى كل من ميثيل سيتوزين وهيدروكسي ميثيل سيتوزين ، لم تكتشف من جديد الميثيل وميثيل الهيدروكسيميثيل الذي نظهره يحدث فقط بشكل عابر أثناء إعادة ترتيب الجينوم. دعم هذه الملاحظات ، وصف تقرير في عام 2003 من جديد مثيلة في الهدبية stichotrichous (وإغلاق O. trifallax نسبيا) Stylonychia lemnae [76]. في هذا العمل ، على الرغم من اكتشافه عند مستويات منخفضة في MIC الخضري ، كان من الممكن اكتشاف مثيلة السيتوزين بشكل أساسي أثناء عمليات إعادة ترتيب الجينوم ، حيث تم تقديمه من جديد ضمن تسلسلات شبيهة باللينقولات المستبعد [76]. كما في O. trifallax النظام ، لوحظ وجود مثيلة في جميع سياقات التسلسل داخل العنصر القابل للنقل ، وتم تجميعها في منطقة تمتد تقريبًا 500 زوج قاعدي [76]. بينما تدعم نتائجنا عمومًا استنتاجات S. lemnae في الدراسة ، يختلف عملنا في بعض النواحي المهمة: أولاً ، نظرًا لأن الهيدروكسي ميثيل لم يتم تحديده بعد كعلامة جينية مهمة في الحمض النووي ، لم يتم تحليله في S. lemnae ثانيا، O. trifallax يحدث مثيلة الحمض النووي / الهيدروكسي ميثيل عند مستوى أعلى بكثير (70٪ -90٪) مما تم الإبلاغ عنه في S. lemnae (25٪) ثالثا ، O. trifallax لديه تعديل كبير على الأقل في عدد قليل من الكروموسومات النووية الكبيرة ومنتجات التضفير الشاذة ، ولم يتم الإبلاغ عن أي منهما S. lemnae رابعًا ، البيانات المقدمة هنا تشير مباشرة إلى الميثلة / الهيدروكسيميثيل في O. trifallaxمسار إزالة الحمض النووي ، وخامسًا ، قمنا بالإبلاغ عن فكرة 20 نقطة أساس يبدو أنها تلعب دورًا في توجيه الميثيل / الهيدروكسيميثيل إلى مناطق معينة من الكروموسومات المحددة. لقد أثبتنا أن عملية مثيلة الحمض النووي تلعب دورًا وظيفيًا مهمًا في القضاء على التسلسلات المتكررة في MIC ، بما في ذلك عائلة transposon الوفيرة للغاية وعائلة تكرار القمر الصناعي الوفيرة. لقد أبلغنا أيضًا عن مثيلة / هيدروكسي ميثيل محددة لعدد صغير من الجزيئات المعاد ترتيبها بشكل شاذ ولكن ليس نظيراتها المعاد ترتيبها بشكل صحيح ، مما يشير إلى دور لتعديل الحمض النووي في إما التعرف على الخطأ أثناء إعادة ترتيب الكروموسوم و / أو تدهور هذه الجزيئات المعاد ترتيبها بشكل غير صحيح.

تدعم البيانات الوظيفية المقدمة هنا دور مثيلة الحمض النووي في مسارات التحلل ، لأن المثيلة تظهر غنية في الحمض النووي من MAC الأبوي ، والذي يستهدف التخلص منه ، بالإضافة إلى التسلسلات المتكررة التي تم حذفها من MIC. وجدنا أن تثبيط نقل ميثيل الحمض النووي بواسطة ديسيتابين أدى إلى إزالة الميثيل بشكل كبير من 6 من 9 كروموسومات MAC وموضع MIC واحد (القمر الصناعي 170 نقطة أساس تكرر الشكل 7 ج). بالتزامن مع فقدان الميثلة الناجم عن الديسيتابين من هذه الكروموسومات ، لاحظنا تراكمًا خفيفًا ولكن مهمًا من الناحية الإحصائية للكروموسومات نفسها (إشارة الحمض النووي الأصلية في الشكل 7 ج). في حين أن هذا التراكم متواضع ، مع زيادة بحد أقصى 1.5 إلى 2 ضعف ، فإن هذه البيانات توفر دعمًا مقنعًا عبر كروموسومات متعددة لصلة حميمية بين مثيلة الحمض النووي / هيدروكسي ميثيل والتدهور أثناء إعادة ترتيب الجينوم.

يأتي المزيد من الدعم للنموذج من فحص الخلايا التي أكملت إعادة ترتيب الجينوم بعد معالجة الآزاسيتيدين والديسيتابين: تكرار القمر الصناعي 170 نقطة أساس وعرض ترانسبوزونات TBE1 تراكمًا مهمًا إحصائيًا بالنسبة إلى عناصر التحكم غير المعالجة (الشكل 8 ب ، ج ، د). بالإضافة إلى ذلك ، يؤدي علاج الآزاسيتيدين إلى تراكم السلالة الجرثومية TEBPα وانخفاض في إصدارات MAC من نفس الجين (الشكل 8 ب ، ج). نلاحظ عيوبًا أخرى في إعادة ترتيب الجينوم عند العلاج بالأزاسيدين أو الديسيتابين: جنبًا إلى جنب TEBPα، يُظهر Contig4414 أيضًا مستويات أقل ، بينما أظهر اثنان من الكروموسومات الأخرى مستويات مرتفعة (Contig18539 و Contig15988) ، بما يتوافق مع الاحتفاظ بصبغيات MAC الأبوية التي لم تتحلل بشكل صحيح. توضح هذه البيانات مدى تعقيد النتائج الوظيفية لتثبيط مثيلة الحمض النووي: قد تكون التأثيرات مباشرة (مثل الفشل في تحلل جزيء معين من الحمض النووي من MAC الأبوي) أو غير مباشر (على سبيل المثال ، إذا لم تتمكن الخلية من إزالة IES بشكل صحيح من نسخة MIC من الجين وبالتالي لا تنتج منتج MAC كافٍ). هناك حاجة إلى مزيد من العمل لفك تشابك هذه التأثيرات ، ولكن ، مجتمعة ، تشير البيانات إلى مسار مثيلة الحمض النووي / مسار الهيدروكسي ميثيل في القضاء على العناصر المتكررة ونسخة واحدة من جينوم MIC وفي إنتاج جينوم كبير النواة.

العلاقة بين مثيلة السيتوزين و hydroxymethylation في O. trifallax يقدم تحديات جديدة. في الفئران ، على سبيل المثال ، يتم ميثلة الحمض النووي للحيوانات المنوية ولكن يتم فقدان مثيلة جينوم الأب بسرعة عند الإخصاب [77] ، حيث يخضع الجنين لإعادة صياغة القواعد اللاجينية وإنشاء أنماط مثيلة جديدة [78 ، 79]. يظهر هيدروكسي ميثيل سيتوزين في النواة الأبوية ، ولكن ليس الأم ، أثناء إعادة الكتابة الدراماتيكية للشفرة اللاجينية [80 ، 81] ، بالتزامن مع فقدان المثيلة الأبوية. ربطت أعمال أخرى بين الهيدروكسي ميثيل وتفعيل محفز خاص بالأنسجة ، ويفترض ، نزع الميثيل أثناء التطور [82]. يعتمد الهيدروكسي ميثيل على مثيلة موجودة مسبقًا وبالتالي يوجد في توتر ديناميكي معها: كلا التعديلين يمكن أن يحددا المناطق الجينومية نفسها [83] ، كما نرى في O. trifallax، وهذه الظاهرة منتشرة بشكل خاص في الخلايا الجذعية الجنينية [84 ، 85]. ومع ذلك ، فإن الهيدروكسي ميثيل يعادي الميثيل أيضًا عن طريق توجيه إزالته و / أو منع بروتينات الكروماتين المتغايرة المرتبطة بالميثيل سيتوزين [86 ، 87]. الارتباط بين المثيلة والتدهور في O. trifallax يقترح أن الكائن الحي قد يستخدم الهيدروكسي ميثيل كقوة موازنة واستقرار ، ربما لاستهداف الجينات المهمة للاقتران. قد تشارك آليات أخرى أيضًا في هذا الارتباط: O. trifallaxأكثر جين بروتين ريبوسوم هيدروكسي ميثيل هو متماثل لـ L12 ، والذي في البكتيريا والخميرة يمكن أن ينظم بدء الريبوسوم واستطالة [88 ، 89]. لذلك ، قد يكون للتغييرات في التعبير عن كروموسوم L12 المشفر تداعيات عبر البروتين ، وربما حتى توقف الترجمة بينما يخضع الكائن الحي للخطوات المعقدة لإعادة تشكيل الجينوم.


ملاحظة الناشر: تظل Springer Nature محايدة فيما يتعلق بالمطالبات القضائية في الخرائط المنشورة والانتماءات المؤسسية.

الشكل التكميلي 1 فحص المركبات المحتوية على البوران والآلية المقترحة لتفاعل البوران لـ 5caC.

(أ) تم فحص المركبات المحتوية على البوران لتحويل 5caC إلى DHU في قلة 11mer ، مع معدل التحويل المقدّر بواسطة MALDI. 2-بيكولين بوران (pic-borane) و borane pyridine و tert-butylamine borane و amonia borane يمكن أن يحول تمامًا 5caC إلى DHU بينما أعطى إيثيلين ديامين بوران وثنائي ميثيل أمين البوران حوالي 30 ٪ فقط من معدل التحويل. لم يتم قياس أي منتجات يمكن اكتشافها (بدون تاريخ) باستخدام مورفولين بوران ، 4 ميثيل مورفولين بوران ، تريميثيل أمين بوران ، وسيكلوهيكسيل أمين بوران. عوامل الاختزال الأخرى مثل بوروهيدريد الصوديوم وثلاثي الصوديوم (أسيتوكسي) بوروهيدريد تتحلل بسرعة في الوسط الحمضي وتؤدي إلى تحويل غير كامل. لم يتم استخدام سيانوبوروهيدريد الصوديوم بسبب احتمالية تكوين سيانيد الهيدروجين تحت الظروف الحمضية. تم اختيار Pic-borane و pyridine borane بسبب التحويل الكامل والسمية المنخفضة والثبات العالي. (ب) الآلية المقترحة لتفاعل البوران لـ 5caC مع DHU.

الشكل التكميلي 2

الآلية المقترحة لتفاعل البوران لـ 5fC مع DHU.

الشكل التكميلي 3 توصيف MALDI لـ 5fC و 5caC يحتوي على أوليغوس DNA النموذجية المعالجة بواسطة pic-borane مع أو بدون حجب 5fC و 5caC.

تم حظر 5fC بواسطة O-ethylhydroxylamine الذي يصبح oxime ويقاوم تحويل pic-borane بينما تم حظر 5caC بواسطة ethylamine عبر اقتران EDC وتحويله إلى amide الذي يمنع التحويل بواسطة pic-borane. تم إجراء جميع التجارب مرة واحدة. تم عرض MS المحسوب باللون الأسود ، وتم عرض MS باللون الأحمر.

الشكل التكميلي 4 توصيف MALDI لـ 5mC و 5hmC يحتوي على نموذج DNA oligos المعالج بواسطة KRuO4 و pic-borane مع أو بدون حجب 5hmC.

يمكن حظر 5hmC بواسطة βGT مع الجلوكوز وتحويلها إلى 5 جم سي. لا يمكن تحويل 5mC و 5hmC و 5gmC بواسطة pic-borane. 5hmC could be oxidized by KRuO4 to 5fC, and then converted to DHU by pic-borane. All experiments were performed once. Calculated MS was shown in black, observed MS was shown in Red.

Supplementary Figure 5 Restriction enzyme digestion showed TAPS effectively converts 5mC to T.

(أ) Illustration of restriction enzyme digestion assay to confirm the sequence change caused by TAPS. (ب) Taq α tests to confirm the C-to-T transition caused by TAPS. A PCR-amplified 222 bp model DNA with Taq α I restriction site in the middle can be cleaved, whereas the amplified product of 5mC-TAPS stayed intact, suggesting loss of the restriction site and hence C-to-T transition. TAPS did not result in C-to-T transition on the unmethylated cytosine since C-TAPS was cleaved in the same way as the original untreated C. Experiment was performed once.

Supplementary Figure 6 Complete C-to-T transition induced after TAPS, TAPSβ and CAPS as indicated by Sanger sequencing.

Model DNA containing single methylated and single hydroxymethylated CpG sites was prepared as described in Supplementary Note 3. TAPS conversion was done following the NgTET1 Oxidation و Pyridine borane reduction protocols described in the أساليب. TAPSβ conversion was done following the 5hmC blocking, NgTET1 Oxidation و Pyridine borane reduction البروتوكولات. CAPS conversion was done following the 5hmC oxidation و Pyridine borane reduction البروتوكولات. After conversion, 1 ng of converted DNA sample was PCR amplified by Taq DNA Polymerase and processed for Sanger sequencing. TAPS converted both 5mC and 5hmC to T. TAPSβ selectively converted 5mC whereas CAPS selectively converted 5hmC. None of the three methods caused conversion on unmodified cytosine and other bases.

Supplementary Figure 7 TAPS is compatible with various DNA and RNA polymerases and induces complete C-to-T transition shown by Sanger sequencing.

The model DNA containing methylated CpG sites for the polymerase test and primer sequences is described in Supplementary Note 3. After TAPS treatment, 5mC was converted to DHU. KAPA HiFi Uracil plus polymerase, Taq polymerase, and Vent exo- polymerase read DHU as T and therefore induce complete C-to-T transition after PCR. Alternatively, primer extension was done with a biotin-labelled primer and isothermal polymerases including Klenow fragment, Bst DNA polymerase, and phi29 DNA polymerase. The newly synthesized DNA strand was separated by Dynabeads® MyOne Streptavidin C1 and then amplified by PCR with Taq polymerase and processed for Sanger sequencing. T7 RNA polymerase could efficiently bypass DHU and insert adenine opposite the DHU site, which is shown by RT-PCR and Sanger sequencing. Other commercial polymerases including KAPA HiFi polymerase, NEB Q5 polymerase, and Phusion polymerase were also tested but failed to amplify DHU containing DNA efficiently.

Supplementary Figure 8 DHU does not show PCR bias compared to T and C.

A model DNA containing one DHU/U/T/C modification was synthesized with the corresponding DNA oligos as described in Supplementary Note 3. Standard curves for each model DNA with DHU/U/T/C modification were plotted based on qPCR reactions with 1:10 serial dilutions of the model DNA input (from 0.1 pg to 1 ng). Every qPCR experiment was run in triplicates (n=3 technical replicates). The slope of the regression between the log concentration (ng) values and the average Ct values was calculated by SLOPE function in Excel. PCR efficiency was calculated using the following equation: Efficiency % = (10^(-1/ Slope)-1)*100% Amplification factor was calculated using the following equation: Amplification factor=10^(-1/Slope). The PCR efficiency for the model DNAs with DHU or T or C modification were almost the same, which demonstrated that DHU could be read through as a regular base and would not cause PCR bias.

Supplementary Figure 9 TAPS completely converted 5mC to T regardless of DNA fragment length.

(أ) Agarose gel images of the TaqαI-digestion assay confirming complete 5mC to T conversion in all samples regardless of DNA fragment length. 194 bp model sequence from the lambda genome was PCR amplified after TAPS and digested with TaqαI enzyme. The PCR product amplified from unconverted sample could be cleaved, whereas products amplified on TAPS treated samples stayed intact, suggesting loss of restriction site and hence complete C-to-T transition. Experiment was performed once. (ب) The C-to-T conversion percentage was estimated by gel band quantification as 100% for all DNA fragment lengths tested.

Supplementary Figure 10 The conversion and false positive rate for different TAPS conditions.

The combination of mTet1 and pyridine borane achieved the highest conversion rate of methylated C (96.5%, calculated with fully CpG methylated Lambda DNA) and the lowest conversion rate of unmodified C (0.23%, calculated with 2kb unmodified spike-in), compared to other conditions with NgTET1 or pic-borane. Shown above are the conversion rates +/- SE of all tested cytosine sites (N of 2kb unmodified positions = 1041, N of covered bacteriophage lambda CpG positions used: mTet1 pyridine borane 6226, mTet1 pic-borane 5871, NgTET1 pyridine borane 5768, NgTET1 pic-borane 6226).

Supplementary Figure 11 TAPS resulted in more even coverage and fewer uncovered positions than WGBS.

Comparison of coverage depth across (أ) all bases (N = 2 725 765 481) and (ب) CpG sites (N = 43 445 914, based on mm9 genome, which includes potential genetic variants in E14 genome) between WGBS and TAPS, computed on both strands. For ‘TAPS (down-sampled)’, random reads out of all mapped TAPS reads were selected so that the median coverage matched the median coverage of WGBS. Positions with coverage above 50× are shown in the last bin.

Supplementary Figure 12 Modification levels around CpG Islands.

Average modification levels in CpG islands (binned into 20 windows) and 4 kb flanking regions (binned into 50 equally sized windows). Bins with coverage below 3 reads were ignored.

Supplementary Figure 13 TAPS exhibits smaller coverage-modification bias than WGBS.

All CpG sites were binned according to their coverage, and the mean (blue) and the median (orange) modification values are shown in each bin for WGBS (أ) and TAPS (ب). The CpG sites covered by more than 100 reads are shown in the last bin. The lines represent a linear fit through the data points.

Supplementary Figure 14 Distribution of modification levels across all chromosomes.

Average modification levels in 100 kb windows along mouse chromosomes, weighted by the coverage of CpG, and smoothed using a Gaussian weighted moving average filter with window size 10.

Supplementary Figure 15 Low-input gDNA and cell-free DNA TAPS libraries prepared with dsDNA KAPA HyperPrep library preparation kit.

Sequencing libraries were successfully constructed with as little as 1 ng of (أ) mESC gDNA and (ب) cell-free DNA with KAPA HyperPrep kit. Experiment was performed once. Note that cell-free DNA has a sharp length distribution around 160 bp (nucleosome size) due to plasma nuclease digestion. After library construction, it becomes

300bp, which is the sharp band in (ب).


شاهد الفيديو: Andrea Bocelli: Amazing Grace Music For Hope Live From Duomo di Milano (شهر نوفمبر 2022).